G445240


Basic Information

Item Value
gene id G445240
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000313
NCBI id null
chromosome length 2068795
location 1841355 ~ 1841537 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU511098
AAAAAGAAGCCATATCTAAACATGATCCAGAAGCGCAGGCGTTTTCTCTGGGCCAAGGCTCATTTAAAATGGACTGTGGCAAAGTGGAAAACTGTTCTGTGGTCAGACGAATCAAAATTTGAAGTTCTTTTTGGAAAACTGGGATGCCATGTCATCCGGACTAAAGAGGACAAGGACAACCCA

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU511098 True 183 lncRNA 0.43 1 1841355 1841537

Neighbor

gene id symbol gene type direction distance location
CI01000313_01771461_01775597 NA coding downstream 65758 1771398 ~ 1775597 (-)
CI01000313_01759780_01760685 MORN2 coding downstream 80670 1759241 ~ 1760685 (-)
CI01000313_01757085_01758655 NA coding downstream 82394 1757085 ~ 1758961 (-)
CI01000313_01704439_01705320 DYNLT1 coding downstream 136035 1704330 ~ 1705320 (-)
CI01000313_01677464_01683934 NA coding downstream 157421 1676498 ~ 1683934 (-)
CI01000313_01860321_01864056 TRMT61B coding upstream 18714 1860251 ~ 1864898 (-)
CI01000313_01896011_01900531 HMGCL coding upstream 54354 1895891 ~ 1901030 (-)
CI01000313_01902080_01911647 GALE, ZBTB8A coding upstream 59829 1901366 ~ 1911647 (-)
CI01000313_01916048_01928894 NA coding upstream 74389 1915926 ~ 1930091 (-)
CI01000313_01937426_01942054 NA coding upstream 94787 1936324 ~ 1942054 (-)
G445239 NA non-coding downstream 1332 1839812 ~ 1840023 (-)
G445233 NA non-coding downstream 10044 1829514 ~ 1831311 (-)
G445216 NA non-coding downstream 42082 1799044 ~ 1799273 (-)
G445203 NA non-coding downstream 107605 1733060 ~ 1733750 (-)
G445128 NA non-coding downstream 124830 1714955 ~ 1716525 (-)
G445226 NA non-coding upstream 23948 1865485 ~ 1947630 (-)
G445230 NA non-coding upstream 46729 1888266 ~ 1893504 (-)
G445253 NA non-coding upstream 97501 1939038 ~ 1991439 (-)
G445291 NA non-coding upstream 196544 2038081 ~ 2038412 (-)
G445292 NA non-coding upstream 200312 2041849 ~ 2042141 (-)
CI01000313_00982839_00997272 NA other downstream 852063 982829 ~ 997590 (-)
G444714 NA other downstream 1441259 397607 ~ 400096 (-)
G444653 NA other downstream 1467891 371520 ~ 373464 (-)

Expression


Co-expression Network