G455408


Basic Information

Item Value
gene id G455408
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000320
NCBI id null
chromosome length 3894707
location 3124699 ~ 3124908 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU522843
GGATTACCCTCCACCAAATCCTCATAACATTTCCCAGAGGCCATATGCAGCTCACCCTCAGTCGTGGGAGTGTGGGCAGAGCTCCACACTCGTACTCCATGAGCATACCAACTGGGACGGCCGATGTTGCAGGCTCACACATATTGTCAGAATCTTCATTGGGCTCATCCTCCGGGGAAATGGTTGTCTCAGGCGTTGTCTCTGGCACTG

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU522843 True 210 lncRNA 0.54 1 3124699 3124908

Neighbor

gene id symbol gene type direction distance location
CI01000320_02841856_03008012 PTPRU, PTPRUA coding upstream 115959 2841090 ~ 3008740 (+)
CI01000320_02787144_02831818 NA coding upstream 292843 2787144 ~ 2831856 (+)
CI01000320_02703432_02709038 NA coding upstream 415577 2703080 ~ 2709122 (+)
CI01000320_02643613_02656509 GMEB1 coding upstream 467285 2643131 ~ 2657414 (+)
CI01000320_02625602_02629500 RAB42A, RB39B, RAB42 coding upstream 493138 2625304 ~ 2631561 (+)
CI01000320_03327551_03328396 NA coding downstream 202643 3327201 ~ 3328396 (+)
CI01000320_03490995_03506693 NA coding downstream 365014 3489922 ~ 3506840 (+)
CI01000320_03552616_03556945 NA coding downstream 427708 3552616 ~ 3557723 (+)
CI01000320_03570242_03578769 NA coding downstream 444507 3569415 ~ 3578835 (+)
CI01000320_03616557_03637085 UB2E2, UBE2E1, UBE2E2 coding downstream 490934 3615842 ~ 3638047 (+)
G455387 NA non-coding upstream 37592 3086712 ~ 3087107 (+)
G455336 NA non-coding upstream 220991 2884278 ~ 2903708 (+)
G455320 NA non-coding upstream 423628 2700777 ~ 2701071 (+)
G455291 NA non-coding upstream 553362 2571033 ~ 2571337 (+)
G455263 NA non-coding upstream 582641 2541774 ~ 2542058 (+)
G455426 NA non-coding downstream 45654 3170562 ~ 3254377 (+)
G455471 NA non-coding downstream 144693 3269601 ~ 3269828 (+)
G455475 NA non-coding downstream 165998 3290906 ~ 3291116 (+)
G455477 NA non-coding downstream 167337 3292245 ~ 3292456 (+)
G455478 NA non-coding downstream 168470 3293378 ~ 3293791 (+)
G455404 NA other upstream 3594 3120816 ~ 3121105 (+)
CI01000320_03117532_03169741 NA other upstream 6732 3115820 ~ 3169749 (+)
G455393 NA other upstream 24410 3099824 ~ 3100289 (+)
G455129 NA other upstream 927691 2190317 ~ 2197008 (+)
G454251 NA other upstream 1909667 1214578 ~ 1215032 (+)
G455418 NA other downstream 32137 3157045 ~ 3157648 (+)

Expression


Co-expression Network