CI01000321_04635524_04639904 (RPS27.1, RPS27, RPS27.2, RPS27.L, RPS27L)


Basic Information

Item Value
gene id CI01000321_04635524_04639904
gene name RPS27.1, RPS27, RPS27.2, RPS27.L, RPS27L
gene type misc
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000321
NCBI id null
chromosome length 5206101
location 4635524 ~ 4640144 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>CI01000321_04635524_04639904.mRNA
CTTGCAAAAGACTTGCTGCACCCCACCCCTGAGGAGGAGAGGAGGAGGCACAAGAAGAAGCGTCTCGTACAGAGTCCCAATTCTTACTTCATGGATGTCAAGTGTCCAGGATGTTATAAGATCACAACGGTGTTCAGCCACGCACAGACGGTCGTGCTTTGTGTCGGTTGCTCAACTGTGCTGTGTCAGCCCACTGGAGGCAAAGCTCGACTCACAGAAGGGTGTTCCTTCAGAAGGAAGCAGCATTAAGATCTTTTCTAGATGCTTCCTCGGAGAGAGAGAGAGGGAAAGAGAGAGAGAGAGGGAGGAGACGGACCGGCCTCAGTGACAGCAGCCTGATTTTATTCAAGCAAGAGATGAGATTATGAGATCCCTGAGAGGTCTGAAGAACCGACCGGAACACCCTCCAACCTAGTGTCTCTTTTTCTCTTTCTGTCTCA

Function

symbol description
rps27.1 Predicted to enable RNA binding activity. Predicted to be a structural constituent of ribosome. Acts upstream of or within erythrocyte differentiation. Predicted to be located in ribosome. Predicted to be part of cytosolic small ribosomal subunit. Human ortholog(s) of this gene implicated in Diamond-Blackfan anemia 17. Orthologous to human RPS27 (ribosomal protein S27).
rps27.2 Predicted to enable RNA binding activity. Predicted to be a structural constituent of ribosome. Predicted to be involved in ribosomal small subunit assembly. Predicted to act upstream of or within translation. Predicted to be located in ribosome. Predicted to be part of cytosolic small ribosomal subunit. Human ortholog(s) of this gene implicated in Diamond-Blackfan anemia 17. Orthologous to human RPS27 (ribosomal protein S27).
rps27l Predicted to enable RNA binding activity. Predicted to be a structural constituent of ribosome. Predicted to be involved in ribosomal small subunit assembly. Predicted to act upstream of or within translation. Predicted to be located in ribosome. Predicted to be part of cytosolic small ribosomal subunit. Orthologous to human RPS27L (ribosomal protein S27 like).
rps27 A structural constituent of ribosome. Involved in rRNA processing. Located in cytosolic ribosome and nucleus. Part of cytosolic small ribosomal subunit. Is active in postsynaptic density. Implicated in Diamond-Blackfan anemia 17.

GO:

id name namespace
GO:0000184 nuclear-transcribed mRNA catabolic process, nonsense-mediated decay biological_process

KEGG:

id description
K02978 RP-S27e, RPS27; small subunit ribosomal protein S27e

RNA

RNA id representative length rna type GC content exon number start site end site
CI01000321_04635524_04639904.mRNA False 440 mRNA 0.51 3 4635524 4640095

Neighbor

gene id symbol gene type direction distance location
CI01000321_04605557_04620142 NA coding upstream 15126 4604965 ~ 4620398 (+)
CI01000321_04567844_04592431 CELF3, CELF3A coding upstream 42953 4567844 ~ 4592571 (+)
CI01000321_04532761_04559105 NA coding upstream 76419 4532761 ~ 4559105 (+)
CI01000321_04524751_04530395 NA coding upstream 104046 4524751 ~ 4531478 (+)
CI01000321_04515562_04517953 MRPS21 coding upstream 117355 4515534 ~ 4518187 (+)
CI01000321_04649973_04674616 CHRNA7 coding downstream 9878 4649973 ~ 4674931 (+)
CI01000321_04716387_04724423 TRIM46, TRIM46B coding downstream 76292 4716387 ~ 4724766 (+)
CI01000321_04748037_04748315 DPM3 coding downstream 107555 4747650 ~ 4749579 (+)
CI01000321_04774523_04814193 NA coding downstream 133744 4773839 ~ 4814239 (+)
CI01000321_04859626_04859952 NA coding downstream 218900 4858995 ~ 4860916 (+)
G459225 NA non-coding upstream 137412 4495458 ~ 4498112 (+)
G459239 NA non-coding upstream 174842 4451626 ~ 4460682 (+)
G459292 NA non-coding upstream 194071 4441177 ~ 4441453 (+)
G459284 NA non-coding upstream 205307 4428730 ~ 4430217 (+)
G459233 NA non-coding upstream 222184 4411006 ~ 4413340 (+)
G459323 NA non-coding downstream 53519 4693614 ~ 4767280 (+)
G459240 NA non-coding downstream 56576 4696671 ~ 4700949 (+)
G459231 NA non-coding downstream 70337 4710432 ~ 4711448 (+)
G459682 NA non-coding downstream 206261 4846356 ~ 4846583 (+)
G459683 NA non-coding downstream 207852 4847947 ~ 4848156 (+)
G459303 NA other upstream 146972 4485397 ~ 4488552 (+)
CI01000321_04013470_04014515 CACNG8 other upstream 621858 4013468 ~ 4015412 (+)
CI01000321_03795430_03804685 SHISA7B, SHISA7 other upstream 832642 3792915 ~ 3805511 (+)
CI01000321_00815160_00819665 NA other upstream 3812677 815160 ~ 819749 (+)

Expression


Co-expression Network