CI01000327_04429751_04432240 (LZTFL1)


Basic Information

Item Value
gene id CI01000327_04429751_04432240
gene name LZTFL1
gene type coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000327
NCBI id null
chromosome length 4453825
location 4429690 ~ 4432240 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>CI01000327_04429751_04432240.mRNA
AGAGTTACTGGAGCAAGTAGCTGAGTTTGAGAAGACTGATTTCAAACCCAACAGCAAGGAGATTTCCAGACTACAAGAGGACAATGACAAATTGAAAGCTAGACTCAGAACTTTGGAATCTCAGGCCATGAGCGCTCTAGATGACAAGTCCAAAGCAGAGAGGGCCTTGAAAGACCTTCAAAAAAGTCAAGGAGATCATCAGGAGATCGCAAATCTGGAAGGCACAGTTGCAGCAATGCAGGCTGACTTTGAAAAGACCCTGAATGCCAACGTTGCTTCTCAAAAAGACCTGCAGGACAGCCTGGTATCCGCTAAACATGACCTGCTTCGTGTCCAGGAGCAACTTTCCCTTGCTGAGAAGGAACTGGAAAAGAAATTTCAGCAGACGGCTGCATACCGCAACATGAAGGAGATTCTCACTAAAAAGAATGAACAGATTAAAGATCTGAGAAAGAGACTACAAAGGTATGAATCAGATGAGTGAACGTTTAACCCACAGGAAACAAATGAAGAGGTCAACTGAGGGACTTTTAATGCATATTAAA

Function

symbol description
lztfl1 Acts upstream of or within negative regulation of smoothened signaling pathway. Located in cytoplasm and nucleus. Is expressed in several structures, including gill; integument; liver; muscle; and pleuroperitoneal region. Human ortholog(s) of this gene implicated in Bardet-Biedl syndrome 17. Orthologous to human LZTFL1 (leucine zipper transcription factor like 1).

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
CI01000327_04429751_04432240.mRNA True 545 mRNA 0.43 6 4429690 4432240

Neighbor

gene id symbol gene type direction distance location
CI01000327_04405469_04408613 CCR9B coding downstream 21077 4405009 ~ 4408613 (-)
CI01000327_04315483_04319983 NA coding downstream 108963 4315369 ~ 4320727 (-)
CI01000327_04232877_04277027 GLI3 coding downstream 152663 4232877 ~ 4277027 (-)
CI01000327_04196209_04202497 GLI3 coding downstream 226220 4195990 ~ 4203470 (-)
CI01000327_04179387_04181415 NA coding downstream 248188 4177944 ~ 4181502 (-)
G472437 NA non-coding downstream 3272 4421909 ~ 4426418 (-)
G472461 NA non-coding downstream 52058 4377236 ~ 4377632 (-)
G472459 NA non-coding downstream 55356 4374099 ~ 4374334 (-)
G472457 NA non-coding downstream 68401 4361090 ~ 4361289 (-)
G472455 NA non-coding downstream 69692 4359625 ~ 4359998 (-)
G472470 NA other downstream 33260 4396090 ~ 4396430 (-)
G472251 NA other downstream 647022 3781696 ~ 3782668 (-)
G470330 NA other downstream 4155395 273732 ~ 274295 (-)

Expression


Co-expression Network

Homologous

species gene id symbol gene type chromosome NCBI id location
bowfin (Amia calva) G37516 NA non-coding CM030124.1 CM030124.1 46548815 ~ 46550555 (+)