G684463


Basic Information

Item Value
gene id G684463
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01180000
NCBI id null
chromosome length 11503085
location 8459937 ~ 8460224 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU805804
TTGCATAAAAGTGGTTTAAACTATTTTTTTCTGTAATTACTGACTTAAGGATTTGAAATGTTTTTGAGAAATATAGAACTCAACCAAAGTAATTTGTAAAGCCATTTTGTTGTTTCAGATGCTGAATGTTAATGTTTTGGAGTTTATAAATAACACTGTCATTATTAACTTTGTTTAAAACATGTTTTGTGTCATTTATACACTCACAGACATCAACATTCGGCATATGAAACACAACAATGGTGACATGCTTCATGCCAGCATACAAAACACATTCATGGCTCCCAG

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU805804 True 288 lncRNA 0.31 1 8459937 8460224

Neighbor

gene id symbol gene type direction distance location
CI01180000_08176665_08187246 FAM160B1 coding downstream 272691 8176624 ~ 8187246 (-)
CI01180000_08123227_08149912 ABLIM1A coding downstream 310025 8123100 ~ 8149912 (-)
CI01180000_08007547_08008834 NA coding downstream 451081 8006735 ~ 8008856 (-)
CI01180000_07995410_08004464 IF3EI, EIF3L, EIF3S6IP coding downstream 455160 7995187 ~ 8004777 (-)
CI01180000_07958912_07969452 NA coding downstream 490485 7958739 ~ 7969452 (-)
CI01180000_08512710_08623387 MDGA1 coding upstream 52486 8512710 ~ 8623387 (-)
CI01180000_08700470_08707817 ZFAND3 coding upstream 239616 8699840 ~ 8707817 (-)
CI01180000_08732856_08740755 BTBD9 coding upstream 272334 8732558 ~ 8741445 (-)
CI01180000_08745988_08748949 GLO1 coding upstream 285697 8745921 ~ 8749376 (-)
CI01180000_08754638_08761116 NA coding upstream 294414 8754638 ~ 8761116 (-)
G684458 NA non-coding downstream 8561 8451099 ~ 8451376 (-)
G684457 NA non-coding downstream 11191 8448411 ~ 8448746 (-)
G684359 NA non-coding downstream 60976 8398746 ~ 8398961 (-)
G684347 NA non-coding downstream 78818 8380724 ~ 8381119 (-)
G684345 NA non-coding downstream 88013 8371599 ~ 8371924 (-)
G684467 NA non-coding upstream 4194 8464418 ~ 8464677 (-)
G684405 NA non-coding upstream 10285 8470509 ~ 8471012 (-)
G684409 NA non-coding upstream 125081 8585305 ~ 8602443 (-)
G684488 NA non-coding upstream 216958 8677182 ~ 8677633 (-)
G684494 NA non-coding upstream 269050 8729274 ~ 8729476 (-)
G684182 NA other downstream 548729 7910761 ~ 7911208 (-)
G684080 NA other downstream 877134 7579404 ~ 7582803 (-)
G684071 NA other downstream 934283 7506890 ~ 7525654 (-)
G684018 NA other downstream 1046805 7403147 ~ 7413132 (-)
G683673 NA other downstream 1697093 6762075 ~ 6762844 (-)
G684493 NA other upstream 262469 8722693 ~ 8723867 (-)
G684929 NA other upstream 1438200 9895316 ~ 9901388 (-)
G686052 NA other upstream 2881392 11341616 ~ 11343496 (-)

Expression


Co-expression Network