G684494


Basic Information

Item Value
gene id G684494
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01180000
NCBI id null
chromosome length 11503085
location 8729274 ~ 8729476 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU805836
TTGTATTTCATGTAGGTTTCCGTAGTGTAGTGGTTATCACGTTCGCCTAACACGCGAAAGGTCCCCGGTTCGAAACCGGGCGGAAACATTGTTTTGAAACTATAAGTTTATTTTACAACAAAATAATCAATTATTCTGTCCTCTTTCATCTACTCATACTACAGTTATTGTTACATTTATTAGTTTTATGTTAAAGACTTAGC

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU805836 True 203 lncRNA 0.35 1 8729274 8729476

Neighbor

gene id symbol gene type direction distance location
CI01180000_08700470_08707817 ZFAND3 coding downstream 21457 8699840 ~ 8707817 (-)
CI01180000_08512710_08623387 MDGA1 coding downstream 105887 8512710 ~ 8623387 (-)
CI01180000_08176665_08187246 FAM160B1 coding downstream 542028 8176624 ~ 8187246 (-)
CI01180000_08123227_08149912 ABLIM1A coding downstream 579362 8123100 ~ 8149912 (-)
CI01180000_08007547_08008834 NA coding downstream 720418 8006735 ~ 8008856 (-)
CI01180000_08732856_08740755 BTBD9 coding upstream 3082 8732558 ~ 8741445 (-)
CI01180000_08745988_08748949 GLO1 coding upstream 16445 8745921 ~ 8749376 (-)
CI01180000_08754638_08761116 NA coding upstream 25162 8754638 ~ 8761116 (-)
CI01180000_08794119_08796998 NA coding upstream 64643 8794119 ~ 8796998 (-)
CI01180000_08817640_08823945 KHDRBS1A, KHDRBS1 coding upstream 87930 8817406 ~ 8824247 (-)
G684488 NA non-coding downstream 51641 8677182 ~ 8677633 (-)
G684409 NA non-coding downstream 126831 8585305 ~ 8602443 (-)
G684405 NA non-coding downstream 258262 8470509 ~ 8471012 (-)
G684467 NA non-coding downstream 264597 8464418 ~ 8464677 (-)
G684463 NA non-coding downstream 269050 8459937 ~ 8460224 (-)
G684509 NA non-coding upstream 197703 8927179 ~ 8927428 (-)
G684514 NA non-coding upstream 223743 8953219 ~ 8953428 (-)
G684553 NA non-coding upstream 296597 9026073 ~ 9026294 (-)
G684554 NA non-coding upstream 309604 9039080 ~ 9039312 (-)
G684555 NA non-coding upstream 309884 9039360 ~ 9039705 (-)
G684493 NA other downstream 5407 8722693 ~ 8723867 (-)
G684182 NA other downstream 818066 7910761 ~ 7911208 (-)
G684080 NA other downstream 1146471 7579404 ~ 7582803 (-)
G684071 NA other downstream 1203620 7506890 ~ 7525654 (-)
G684018 NA other downstream 1316142 7403147 ~ 7413132 (-)
G684929 NA other upstream 1168948 9895316 ~ 9901388 (-)
G686052 NA other upstream 2612140 11341616 ~ 11343496 (-)

Expression


Co-expression Network

Homologous

species gene id symbol gene type chromosome NCBI id location
rainbow trout (Oncorhynchus mykiss) trnav-aac-345 NA coding NW_023494034.1 JAAXML020000891.1 17169 ~ 17241 (-)
eurasian perch (Perca fluviatilis) trnav-aac_1 NA coding NC_053122.1 CM020919.1 8872612 ~ 8872684 (+)
striped catfish (Pangasianodon hypophthalmus) trnav-aac_20 NA coding NC_047609.1 CM018555.1 4264453 ~ 4264525 (+)
tiger barb (Puntius tetrazona) trnav-aac_28 NA coding NC_056719.1 CM032088.1 11546959 ~ 11547031 (-)
tiger barb (Puntius tetrazona) trnas-aga_51 NA coding NC_056702.1 CM032071.1 26078194 ~ 26078275 (+)
mexican tetra (Astyanax mexicanus) trnav-aac_20 NA coding NC_035919.1 CM008322.1 8940311 ~ 8940383 (+)