G684514


Basic Information

Item Value
gene id G684514
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01180000
NCBI id null
chromosome length 11503085
location 8953219 ~ 8953428 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU805859
CTGACACTTTGATGCTTCAAAAAGTTCGTAAAGAGATCAGAACAGATTGAATTTAGGCTTTTATTCACATATAAACATTCATCAACTCACACATCAGTTGTGGTAAACGGAAGCTCAAGCATGTTTGACATGCGAGAACCAATGAGGTTCGTTCTCGTGTGTTATGCAGCACGTTTGAGCTTCCGGAAGAGGTTGTTCTCGCATGTCAAG

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU805859 True 210 lncRNA 0.41 1 8953219 8953428

Neighbor

gene id symbol gene type direction distance location
CI01180000_08884283_08892303 NA coding downstream 60542 8883846 ~ 8892677 (-)
CI01180000_08863723_08881179 NA coding downstream 70929 8863288 ~ 8882290 (-)
CI01180000_08829933_08835423 CHP1, CHP2 coding downstream 117796 8829695 ~ 8835423 (-)
CI01180000_08817640_08823945 KHDRBS1A, KHDRBS1 coding downstream 128972 8817406 ~ 8824247 (-)
CI01180000_08794119_08796998 NA coding downstream 156221 8794119 ~ 8796998 (-)
CI01180000_09031248_09034339 NA coding upstream 77597 9031025 ~ 9034339 (-)
CI01180000_09046542_09058939 NA coding upstream 92907 9046335 ~ 9058939 (-)
CI01180000_09106473_09108762 DESI2, DESI2.L coding upstream 152320 9105748 ~ 9108762 (-)
CI01180000_09117251_09118408 NA coding upstream 163680 9117108 ~ 9118652 (-)
CI01180000_09154162_09158438 ZBTB18 coding upstream 200450 9153878 ~ 9158438 (-)
G684509 NA non-coding downstream 25791 8927179 ~ 8927428 (-)
G684494 NA non-coding downstream 223743 8729274 ~ 8729476 (-)
G684488 NA non-coding downstream 275586 8677182 ~ 8677633 (-)
G684409 NA non-coding downstream 350776 8585305 ~ 8602443 (-)
G684405 NA non-coding downstream 482207 8470509 ~ 8471012 (-)
G684553 NA non-coding upstream 72645 9026073 ~ 9026294 (-)
G684554 NA non-coding upstream 85652 9039080 ~ 9039312 (-)
G684555 NA non-coding upstream 85932 9039360 ~ 9039705 (-)
G684429 NA non-coding upstream 111501 9064929 ~ 9065544 (-)
G684559 NA non-coding upstream 114273 9067701 ~ 9068096 (-)
G684493 NA other downstream 229352 8722693 ~ 8723867 (-)
G684182 NA other downstream 1042011 7910761 ~ 7911208 (-)
G684080 NA other downstream 1370416 7579404 ~ 7582803 (-)
G684071 NA other downstream 1427565 7506890 ~ 7525654 (-)
G684018 NA other downstream 1540087 7403147 ~ 7413132 (-)
G684929 NA other upstream 944996 9895316 ~ 9901388 (-)
G686052 NA other upstream 2388188 11341616 ~ 11343496 (-)

Expression


Co-expression Network