CI01180000_08829933_08835423 (CHP1, CHP2)


Basic Information

Item Value
gene id CI01180000_08829933_08835423
gene name CHP1, CHP2
gene type coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01180000
NCBI id null
chromosome length 11503085
location 8829695 ~ 8835423 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>CI01180000_08829933_08835423.mRNA
CGAGAAGACTTCCAGAGGATTCCCGAGTTGGCCATAAATCCTCTTGGTGATCGGATAATTAATGCCTTCTTCCCAGAGGGGGAGGACCAGGTGAACTTTAGAGGCTTCATGAGGACTCTGGCTCACTTCCGTCCTGTGGAGGACAACGAGAAAAACAAAGACCTGTCATCTGGAGAGCCTCTCAACAGCAGGACCAACAAACTCCTCTGCGCTTTCCGGTTATACGACCTCGACAGAGACGACAAGATTTCCAGAGACGAGCTGCTACAGGTGCTGAGAATGATGGTGGGGGTGAATATTTCTGATGAGCAGCTTGGAAGCATTGCAGATAGAACCATCCAGGAGGCTGACACTAACGGAGACATGTGTATCTCATTCAATGAGTTCACCAAGGTGTTGGAAAAAGTGGACGTCGAACAAAAGATGAGCATACGCTTCCTTCACTGAAGACCAAACGCGTTCTGAACTCTTGAGTGGAGACAATACGTGTCAATATAGATAAGACACGCCCCCAATTCTTATTTCTGTGGGCCGATTCGTGCTTGATAAACATGATTGCGTTGTCCTGGTTACTTCTGTTCCAATCATCTGTCACTCTTGAGTTGCTGTTGCACTAGATGGACAGCATGTCCTGGTGCCTTCACTGTTCTCAAAAGTCACTGCGGCTTTTTTCTCGTATATTAAAA

Function

symbol description
chp1 Predicted to enable calcium ion binding activity. Is expressed in pronephric duct and pronephros. Human ortholog(s) of this gene implicated in spastic ataxia. Orthologous to human CHP1 (calcineurin like EF-hand protein 1).
chp2 Predicted to enable calcium ion binding activity. Orthologous to human CHP2 (calcineurin like EF-hand protein 2).

GO:

id name namespace
GO:0032417 positive regulation of sodium biological_process

KEGG:

id description
K17610 CHP, CHP1; calcineurin B homologous protein 1

RNA

RNA id representative length rna type GC content exon number start site end site
CI01180000_08829933_08835423.mRNA True 686 mRNA 0.47 5 8829695 8835423

Neighbor

gene id symbol gene type direction distance location
CI01180000_08817640_08823945 KHDRBS1A, KHDRBS1 coding downstream 5448 8817406 ~ 8824247 (-)
CI01180000_08794119_08796998 NA coding downstream 32697 8794119 ~ 8796998 (-)
CI01180000_08754638_08761116 NA coding downstream 68579 8754638 ~ 8761116 (-)
CI01180000_08745988_08748949 GLO1 coding downstream 80319 8745921 ~ 8749376 (-)
CI01180000_08732856_08740755 BTBD9 coding downstream 88250 8732558 ~ 8741445 (-)
CI01180000_08863723_08881179 NA coding upstream 27865 8863288 ~ 8882290 (-)
CI01180000_08884283_08892303 NA coding upstream 48423 8883846 ~ 8892677 (-)
CI01180000_08908610_08974338 NA coding upstream 73008 8908431 ~ 8974370 (-)
CI01180000_09031248_09034339 NA coding upstream 195602 9031025 ~ 9034339 (-)
CI01180000_09046542_09058939 NA coding upstream 210912 9046335 ~ 9058939 (-)
G684494 NA non-coding downstream 100219 8729274 ~ 8729476 (-)
G684488 NA non-coding downstream 152062 8677182 ~ 8677633 (-)
G684409 NA non-coding downstream 227252 8585305 ~ 8602443 (-)
G684405 NA non-coding downstream 358683 8470509 ~ 8471012 (-)
G684467 NA non-coding downstream 365018 8464418 ~ 8464677 (-)
G684509 NA non-coding upstream 91756 8927179 ~ 8927428 (-)
G684514 NA non-coding upstream 117796 8953219 ~ 8953428 (-)
G684553 NA non-coding upstream 190650 9026073 ~ 9026294 (-)
G684554 NA non-coding upstream 203657 9039080 ~ 9039312 (-)
G684555 NA non-coding upstream 203937 9039360 ~ 9039705 (-)
G684493 NA other downstream 105828 8722693 ~ 8723867 (-)
G684182 NA other downstream 918487 7910761 ~ 7911208 (-)
G684080 NA other downstream 1246892 7579404 ~ 7582803 (-)
G684071 NA other downstream 1304041 7506890 ~ 7525654 (-)
G684018 NA other downstream 1416563 7403147 ~ 7413132 (-)
G684929 NA other upstream 1063001 9895316 ~ 9901388 (-)
G686052 NA other upstream 2506193 11341616 ~ 11343496 (-)

Expression


Co-expression Network

Homologous

species gene id symbol gene type chromosome NCBI id location