XLOC_019052 (rps14)


Basic Information

Item Value
gene id XLOC_019052
gene name rps14
gene type coding
species zebrafish (Danio rerio)
category of species model fish

Chromosome Information

Item Value
chromosome id NC_007132.7
NCBI id CM002905.2
chromosome length 45934066
location 33454147 ~ 33458430 (+)
genome version GRCz11_2017_zebrafish_Genome

Sequence

>TCONS_00037780
CGATTAGAGACACACATAGCAATGGCTCCTCGCAAGGGTAAGGAAAAGAAGGAAGAGCAGGTCATCAGCCTAGGACCTCAGGTAGCTGAGGGGGAGAATGTGTTTGGAGTTTGTCACATCTTCGCATCCTTCAACGACACCTTTGTGCACGTCACTGATCTGTCTGGCAAAGAAACAATTTGCCGTGTGACTGGTGGGATGAAGGTGAAGGCCGACAGAGATGAGTCTTCTCCTTATGCTGCTATGTTGGCAGCTCAGGATGTGGCTCAAAAGTGCAAAGAGCTGGGCATCACTGCTCTGCACATCAAGCTGAGGGCCACTGGTGGAAACAGAACCAAGACTCCTGGACCAGGGGCACAGTCTGCCCTCAGGGCTCTAGCTCGTTCCGGCATGAAGATTGGTCGTATCGAGGACGTCACCCCCATTCCATCAGACAGCACCCGCAGAAAGGGAGGTCGTCGTGGACGTCGTCTGTAATCTATTGGATATTTTTCAGAATAAAGTGTC

Function

symbol description
rps14 Predicted to enable mRNA 5'-UTR binding activity and small ribosomal subunit rRNA binding activity. Predicted to be a structural constituent of ribosome. Acts upstream of or within chordate embryonic development and erythrocyte maturation. Predicted to be located in ribosome. Predicted to be part of cytosolic small ribosomal subunit. Used to study chromosome 5q deletion syndrome. Human ortholog(s) of this gene implicated in chromosome 5q deletion syndrome. Orthologous to human RPS14 (ribosomal protein S14).

GO:

id name namespace
GO:0000028 ribosomal small subunit assembly biological_process
GO:0043009 chordate embryonic development biological_process
GO:0048821 erythrocyte development biological_process
GO:0006412 translation biological_process
GO:0000462 maturation of SSU-rRNA from tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA) biological_process
GO:0043249 erythrocyte maturation biological_process
GO:0022627 cytosolic small ribosomal subunit cellular_component
GO:0005840 ribosome cellular_component
GO:0003735 structural constituent of ribosome molecular_function
GO:0048027 mRNA 5'-UTR binding molecular_function
GO:0070181 small ribosomal subunit rRNA binding molecular_function

KEGG:

id description
ko03010 Ribosome
ko05171 Coronavirus disease - COVID-19
ko03011 Ribosome

ZFIN:

id description
ZDB-GENE-030131-8631 Predicted to enable mRNA 5'-UTR binding activity and small ribosomal subunit rRNA binding activity. Predicted to be a structural constituent of ribosome. Acts upstream of or within chordate embryonic development and erythrocyte maturation. Predicted to be located in ribosome. Predicted to be part of cytosolic small ribosomal subunit. Used to study chromosome 5q deletion syndrome. Human ortholog(s) of this gene implicated in chromosome 5q deletion syndrome. Orthologous to human RPS14 (ribosomal protein S14).

Ensembl:

ensembl_id ENSDARG00000036629

RNA

RNA id representative length rna type GC content exon number start site end site
TCONS_00037780 True 507 mRNA 0.52 5 33454147 33458430

Neighbor

gene id symbol gene type direction distance location
XLOC_019051 NA coding upstream 6537 33249220 ~ 33447610 (+)
XLOC_019050 BX072577.1 coding upstream 241722 33187992 ~ 33212425 (+)
XLOC_019049 arl3l1 coding upstream 266234 33172526 ~ 33187913 (+)
XLOC_019048 NA coding upstream 424516 33027901 ~ 33029631 (+)
XLOC_019047 adra2db coding upstream 632725 32820175 ~ 32821422 (+)
XLOC_019053 cd74b coding downstream 1094 33459524 ~ 33463894 (+)
XLOC_019054 NA coding downstream 5994 33464424 ~ 33465807 (+)
XLOC_019055 clint1b coding downstream 45405 33503835 ~ 33550282 (+)
XLOC_019056 BX005313.2 coding downstream 178653 33637083 ~ 33646932 (+)
XLOC_019057 BX005313.1 coding downstream 297680 33756110 ~ 33765245 (+)
XLOC_019046 NA non-coding upstream 696189 32755414 ~ 32757958 (+)
XLOC_019045 CR735104.1 non-coding upstream 926803 32464568 ~ 32527344 (+)
XLOC_019044 NA non-coding upstream 1042500 32406763 ~ 32411647 (+)
XLOC_019059 NA non-coding downstream 620305 34078735 ~ 34086225 (+)
XLOC_019066 NA non-coding downstream 1471154 34929584 ~ 34943930 (+)

Expression


Co-expression Network

Homologous

species gene id symbol gene type chromosome NCBI id location
grasscarp (Ctenopharyngodon idella) CI01000006_00488543_00492255 RS14, BRAFLDRAFT_113666, RPS14 coding CI01000006 null 488518 ~ 492833 (-)
bowfin (Amia calva) AMCG00011337 rps14,RPS14,LOC100194652 coding CM030133.1 CM030133.1 19410611 ~ 19414281 (+)