G64313 (ablim1)


Basic Information

Item Value
gene id G64313
gene name ablim1
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information

Item Value
chromosome id NC_048565.1
NCBI id CM023219.2
chromosome length 95772356
location 58662213 ~ 58662478 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence

>TU71259
CAGTTCCAAAATAGGAGAATGCACTTCAAAATAAGTGCCTGTAGGTTTCGGGTGAGGGTTCTTACTTGCAGATGGTGCAGACGAAGCAGGCAGGGTGGTAGGTCTTGCCCAGAGCAGTGACGACCTCTCCCTCCACAAAGTCCCCACAGCCATTGCAGCGCGTCCCGTGCATTCGCTGGTAGTCCAGGGTACACAGGTAGTCTCCATTCTTCATGAAGAAGCCTCCCTGAGCCAGGTCACAGCCACACACTGCAGGGACACAAAAG

Function

symbol description
ablim1 Predicted to enable actin filament binding activity. Acts upstream of or within cilium assembly and lamellipodium assembly. Located in lamellipodium and stress fiber.

NR:

description
PREDICTED: actin-binding LIM protein 1 isoform X10

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU71259 True 266 lncRNA 0.40 1 58662213 58662478

Neighbor

gene id symbol gene type direction distance location
LOC110525578 NA coding upstream 698390 57961716 ~ 57963823 (+)
wdr11 wdr11 coding upstream 724225 57806134 ~ 57940604 (+)
LOC110525562 LOC106576893 coding upstream 896815 57622267 ~ 57765398 (+)
LOC118964920 NA coding upstream 940188 57694498 ~ 57722025 (+)
vsir cssa18h10orf54 coding upstream 1599362 57035608 ~ 57062851 (+)
fam160b1 fam160b1 coding downstream 145892 58808370 ~ 58838199 (+)
trnaa-ugc NA coding downstream 399329 59061807 ~ 59061880 (+)
LOC110525756 NA coding downstream 547528 59210006 ~ 59212175 (+)
erlin1 LOC106576878 coding downstream 621846 59284324 ~ 59299682 (+)
si:ch211-217g15.3 LOC106576876 coding downstream 678061 59340539 ~ 59342276 (+)
G64312 NA non-coding upstream 267 58661711 ~ 58661946 (+)
G64242 LOC106586415 non-coding upstream 647 58591113 ~ 58661566 (+)
G64241 NA non-coding upstream 63700 58596708 ~ 58598513 (+)
G64293 NA non-coding upstream 74100 58587833 ~ 58588113 (+)
G64248 NA non-coding upstream 75519 58585290 ~ 58586694 (+)
G64324 NA non-coding downstream 19268 58681746 ~ 58682194 (+)
G64325 NA non-coding downstream 20265 58682743 ~ 58682956 (+)
G64336 NA non-coding downstream 34222 58696700 ~ 58697100 (+)
G64339 NA non-coding downstream 37978 58700456 ~ 58700805 (+)
G64341 NA non-coding downstream 39677 58702155 ~ 58702398 (+)
G64292 NA other upstream 74628 58586858 ~ 58587585 (+)
G63959 fgfr2 other upstream 439083 58221522 ~ 58223130 (+)
G63958 NA other upstream 494035 58166565 ~ 58168178 (+)
G61806 NA other upstream 2410198 56249888 ~ 56252015 (+)
G61804 NA other upstream 2414443 56246584 ~ 56247770 (+)
G64315 NA other downstream 2856 58665334 ~ 58665906 (+)
G64338 NA other downstream 36818 58699296 ~ 58700379 (+)
G65442 NA other downstream 662158 59324636 ~ 59325129 (+)
G66188 NA other downstream 1279008 59941486 ~ 59942064 (+)
G67806 LOC106581772 other downstream 2652396 61314874 ~ 61315252 (+)

Expression


Co-expression Network