XLOC_002135


Basic Information

Item Value
gene id XLOC_002135
gene name NA
gene type non-coding
species zebrafish (Danio rerio)
category of species model fish

Chromosome Information

Item Value
chromosome id NC_007121.7
NCBI id CM002894.2
chromosome length 45420867
location 24097055 ~ 24097310 (+)
genome version GRCz11_2017_zebrafish_Genome

Sequence

>TCONS_00005711
tatgtccgcggtttaattactctgctagacatctcgatagtgaaaacatccgagaagcattattccaacaaaacatttgtttttaagttgttttttctgtctctgcgactcagaaagcctttgtcccgcccttacgtttcacgcaaaaacacacacaaaaaaaaaggtcgactgtgattggccagttttcatgtcagtcaaatcacgcttcagaatcaattcggaaactgattttcagcagcttatgacaaattgt

Function

GO:

id name namespace
GO:0006974 cellular response to DNA damage stimulus biological_process
GO:0006259 DNA metabolic process biological_process
GO:0006281 DNA repair biological_process
GO:0006290 pyrimidine dimer repair biological_process
GO:0044424 obsolete intracellular part cellular_component
GO:0005622 intracellular anatomical structure cellular_component
GO:0043229 intracellular organelle cellular_component

KEGG:

id description
ko03230 Viral genome structure
ko05164 Influenza A
ko03200 Viral proteins

RNA

RNA id representative length rna type GC content exon number start site end site
TCONS_00005711 True 256 lncRNA 0.39 1 24097055 24097310

Neighbor

gene id symbol gene type direction distance location
XLOC_002134 NA coding upstream 585 24096239 ~ 24096470 (+)
XLOC_002132 NA coding upstream 104138 23983307 ~ 23992917 (+)
XLOC_002131 NA coding upstream 505997 23588675 ~ 23591058 (+)
XLOC_002130 CR847844.2 coding upstream 537511 23553533 ~ 23559544 (+)
XLOC_002129 zmp:0000001103 coding upstream 546099 23548674 ~ 23550956 (+)
XLOC_002136 NA coding downstream 219543 24316853 ~ 24375160 (+)
XLOC_002137 CU467963.3 coding downstream 256440 24353750 ~ 24353866 (+)
XLOC_002138 CT573163.1 coding downstream 299788 24397098 ~ 24398671 (+)
XLOC_002139 NA coding downstream 307380 24404690 ~ 24412025 (+)
XLOC_002140 paxbp1 coding downstream 324707 24422017 ~ 24493323 (+)
XLOC_002128 NA non-coding upstream 552989 23542617 ~ 23544066 (+)
XLOC_002122 CT827808.1 non-coding upstream 679108 23417833 ~ 23417947 (+)
XLOC_002144 NA non-coding downstream 553553 24650863 ~ 24655184 (+)

Expression


Co-expression Network