G383283 (cacna1b)



Basic Information


Item Value
gene id G383283
gene name cacna1b
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048569.1
NCBI id CM023223.2
chromosome length 100798064
location 25791764 ~ 25791981 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU435493
CTGCTTCAAGAGGCCTAGGTCGTGGGTCTCTCCAGGGGAGGTGGAGCGGCTGGGGCCAGCTGACTTGGTGTGGCAGTGCTCCCTGCCTACGTAGCGCTCACAGGAGTAGTAACGCTTCGTCTCCCCGGCTGCAGAGTGGTGCCTCTTCTCATGAGGCCGGCCGCGGTCACACTCCCTCGCCCGCTCTCTGGTCAAGCCCTCCACAGGGGGGTCAACAG

Function


symbol description
cacna1b Enables high voltage-gated calcium channel activity and protein C-terminus binding activity. Involved in modulation of chemical synaptic transmission and response to amyloid-beta. Predicted to be located in dendrite; membrane; and neuronal cell body. Predicted to be part of voltage-gated calcium channel complex. Predicted to be active in Schaffer collateral - CA1 synapse and glutamatergic synapse. Implicated in Lambert-Eaton myasthenic syndrome and dystonia 23. Biomarker of multiple sclerosis.

NR:

description
voltage-gated calcium channel subunit Cav2.2 variant I

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU435493 True 218 lncRNA 0.65 1 25791764 25791981

Neighbor


gene id symbol gene type direction distance location
LOC110523492 LOC106567536 coding downstream 350410 25437411 ~ 25441794 (-)
LOC110522839 LOC106567541 coding downstream 644930 24776769 ~ 25146834 (-)
LOC110523489 NA coding downstream 787581 25002552 ~ 25004183 (-)
tnfrsfa LOC106567553 coding downstream 967859 24781562 ~ 24823905 (-)
LOC110522849 NA coding downstream 1059126 24729725 ~ 24732638 (-)
LOC110523504 LOC106567272 coding upstream 399049 26191030 ~ 26231833 (-)
LOC110523507 LOC106567301 coding upstream 484710 26276691 ~ 26285224 (-)
fut7 LOC106567339 coding upstream 578637 26370618 ~ 26381676 (-)
zgc:113162 LOC106566205 coding upstream 726149 26518130 ~ 26549900 (-)
LOC110523513 camkk2 coding upstream 758425 26550406 ~ 26572788 (-)
G383279 NA non-coding downstream 6367 25785082 ~ 25785397 (-)
G383276 NA non-coding downstream 9212 25782341 ~ 25782552 (-)
G383273 NA non-coding downstream 11513 25779993 ~ 25780251 (-)
G383272 NA non-coding downstream 12566 25778930 ~ 25779198 (-)
G383216 NA non-coding downstream 53928 25685610 ~ 25737836 (-)
G383284 NA non-coding upstream 2464 25794445 ~ 25795402 (-)
G383290 NA non-coding upstream 15522 25807503 ~ 25815655 (-)
G383373 NA non-coding upstream 133889 25925870 ~ 25926100 (-)
G383465 NA non-coding upstream 271657 26063638 ~ 26121698 (-)
G383550 NA non-coding upstream 404282 26196263 ~ 26196839 (-)
G380648 NA other downstream 2029957 23759039 ~ 23761807 (-)
G380610 LOC106567829 other downstream 2079873 23709798 ~ 23711891 (-)
LOC110522831 LOC106563032 other downstream 2235221 23488916 ~ 23556681 (-)
jmy LOC106568093 other downstream 2989513 22799696 ~ 22859199 (-)
G383422 NA other upstream 204825 25996806 ~ 25998780 (-)
G385617 NA other upstream 2217286 28009267 ~ 28010077 (-)
G385769 NA other upstream 2422562 28214543 ~ 28214819 (-)
G386126 NA other upstream 2559794 28351775 ~ 28354745 (-)
G386222 NA other upstream 2698985 28490966 ~ 28491372 (-)

Expression



Co-expression Network