G1459602 (usp48)


Basic Information

Item Value
gene id G1459602
gene name usp48
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information

Item Value
chromosome id NC_048581.1
NCBI id CM023235.2
chromosome length 95212422
location 50462471 ~ 50462950 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence

>TU1669871
CAAAAAGTCAACAATCTAAAATGGGAAGTGTTCGTACCTTCAGACAGATGACGCTCTCTGGGATGACTCCTAGGCTGCCGAGGGTGGCAGAATCGTCCGTAAGACACCGGCCGTCGATCGACAGGTTCTGATCAAACGGGGCCACGGAGAAGGCGTGCATGATCTGTATTTTCAACTCCTTGAGCGTCTGATTGGCTGAGACGATGAGTGCTTTCTCTCCCCGGAGCTTCCTGTGCCTCGTGCTCCTCCTGATCCCCGATTTGCCACCACTGGCCATGGGGGTGGGACTTGCAGCAGCACTGACGGTGCCATCACTCAGCTTCTGACGCTTTGCCCCGTCCTCTGACTGGACAGAGGGTCATGTGACCAGGAAGCAAGGGCAA

Function

symbol description
usp48 Predicted to enable cysteine-type endopeptidase activity and thiol-dependent deubiquitinase. Acts upstream of or within cranial skeletal system development. Predicted to be active in cytosol and nucleus. Orthologous to human USP48 (ubiquitin specific peptidase 48).

NR:

description
ubiquitin carboxyl-terminal hydrolase 48-like isoform X2

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU1669871 True 383 lncRNA 0.56 2 50462471 50462950

Neighbor

gene id symbol gene type direction distance location
LOC110494981 LOC106565126 coding upstream 16823 50438670 ~ 50445648 (+)
atxn7l2a LOC106565127 coding upstream 24859 50427145 ~ 50437612 (+)
sypl2a LOC106565128 coding upstream 39606 50408676 ~ 50422865 (+)
LOC110494971 LOC106565129 coding upstream 59607 50400347 ~ 50402864 (+)
LOC110494986 LOC106565131 coding upstream 75529 50382072 ~ 50386942 (+)
ldlrad2 LOC106565124 coding downstream 25774 50483057 ~ 50500086 (+)
LOC110494989 LOC106565121 coding downstream 47469 50510419 ~ 50543166 (+)
LOC110494982 LOC106565312 coding downstream 195091 50658041 ~ 50664680 (+)
LOC110494953 LOC106565294 coding downstream 202228 50665178 ~ 50697862 (+)
kctd20 LOC106565116 coding downstream 239212 50702162 ~ 50708829 (+)
G1459622 NA non-coding upstream 6012 50456201 ~ 50456459 (+)
G1459620 zbtb40 non-coding upstream 7887 50454092 ~ 50454584 (+)
G1459619 NA non-coding upstream 8696 50453483 ~ 50453775 (+)
G1459618 NA non-coding upstream 9021 50452780 ~ 50453450 (+)
G1459640 NA non-coding downstream 33048 50495998 ~ 50496367 (+)
G1459592 NA non-coding downstream 40016 50502966 ~ 50504128 (+)
G1459600 NA non-coding downstream 41316 50504266 ~ 50504512 (+)
G1459656 NA non-coding downstream 80904 50543854 ~ 50544820 (+)
LOC110494957 qrich1 other upstream 278775 50181045 ~ 50192699 (+)
G1458807 NA other upstream 1023142 49439006 ~ 49439329 (+)
erc2 LOC106583361 other upstream 1422115 48866589 ~ 49040356 (+)
bsnb LOC106565168 other upstream 1741227 48693321 ~ 48814670 (+)
G1459769 NA other downstream 313579 50776529 ~ 50777072 (+)
LOC110494047 btg2 other downstream 431990 50894903 ~ 50897444 (+)
G1460249 LOC106565103 other downstream 617182 51080132 ~ 51137770 (+)
G1464092 LOC106565344 other downstream 3711064 54147039 ~ 54189617 (+)
LOC110494100 LOC106565348 other downstream 3793431 54256327 ~ 54264616 (+)

Expression


Co-expression Network