Fish Transcriptome and Expression Database

Home /
Search /
- Gene
- RNA
- Bioproject
Expression /
Analysis /
- Coding ability prediction
- Expression count
- Visual Omics
Tools /
- Neighbor
- BLAST
Statistics /
Download /
Help

model fish

XLOC_035671

Basic Information

Item	Value
gene id	XLOC_035671
gene name	NA
gene type	non-coding
species	zebrafish (Danio rerio)
category of species	model fish

Chromosome Information

Item	Value
chromosome id	NC_007119.7
NCBI id	CM002892.2
chromosome length	54304671
location	23898723 ~ 23907373 (+)
genome version	GRCz11_2017_zebrafish_Genome

Sequence

>TCONS_00071930
CTGGAAAAAATCCTGTTTTTGTCTTCTCCGATGCAGTTTTTGGAGCTGCTCAAACTCCTGGAGGTTATATCTACTCATCATGCCATTGGATAGGAACGGATCTGAAGTCTGCAGAGCTTTGTGAGGTCAACTCCTTAGTTTACACCTTTTGCAAGCATTGGCTTGTTCTTTTGTTATCAAAGGTCATTTTCAAAGGCTTTCTTCAG

Function

GO: NA

KEGG:

id	description
ko03230	Viral genome structure
ko05164	Influenza A
ko03200	Viral proteins

RNA

RNA id	representative	length	rna type	GC content	exon number	start site	end site
TCONS_00071930	True	206	lncRNA	0.41	2	23898723	23907373

Notice the +/- strand.
Display format: symbol/gene id: RNA id. (Except when gene id is similar to RNA id.)
You can browse transcripts by dragging.
A more detailed transcript can be viewed by the zoom button in the upper right corner.

Neighbor

gene id	symbol	gene type	direction	distance	location
XLOC_035670	srpk1a	coding	upstream	19328	23861461 ~ 23879395 (+)
XLOC_035669	mapk14a	coding	upstream	38004	23826985 ~ 23860719 (+)
XLOC_035668	si:ch211-163l21.10	coding	upstream	72639	23809843 ~ 23826084 (+)
XLOC_035667	ELAPOR1	coding	upstream	89037	23783066 ~ 23809686 (+)
XLOC_035666	AL929282.1	coding	upstream	117329	23781005 ~ 23781394 (+)
XLOC_035672	cpne5a	coding	downstream	9274	23916647 ~ 24076844 (+)
XLOC_035673	CT573357.1	coding	downstream	10215	23917588 ~ 23920716 (+)
XLOC_035674	AL928881.1	coding	downstream	156837	24064210 ~ 24064295 (+)
XLOC_035675	CT025875.1	coding	downstream	202672	24110045 ~ 24151252 (+)
XLOC_035676	mmp9	coding	downstream	374139	24281512 ~ 24295947 (+)
XLOC_035657	NA	non-coding	upstream	425857	23462818 ~ 23472866 (+)
XLOC_035652	CR762393.1	non-coding	upstream	555725	23342883 ~ 23342998 (+)
XLOC_035651	NA	non-coding	upstream	633050	23260411 ~ 23265673 (+)
XLOC_035649	NA	non-coding	upstream	653372	23242379 ~ 23245351 (+)
XLOC_035678	NA	non-coding	downstream	441108	24348481 ~ 24350244 (+)
XLOC_035679	NA	non-coding	downstream	510496	24417869 ~ 24692136 (+)
XLOC_035680	NA	non-coding	downstream	673497	24580870 ~ 24588948 (+)
XLOC_035648	NA	non-coding	upstream	646115	23240267 ~ 23252608 (+)

Expression

Co-expression Network