G125702


Basic Information

Item Value
gene id G125702
gene name NA
gene type non-coding
species eurasian perch (Perca fluviatilis)
category of species economic fish

Chromosome Information

Item Value
chromosome id NC_053123.1
NCBI id CM020920.1
chromosome length 39440604
location 20686697 ~ 20687047 (+)
genome version GENO_Pfluv_1.0_2020_eurasian_perch_Genome

Sequence

>TU169071
gggcctcattcaccaaccgttcttacgaagaaatgtgttcttaaacccttcttacgaactttttacgaagattctggcattcactaatgttttcttaacttggatttgttcttagctaagaacaaaatctacgaacactgaaaagcactcttacgcacatttgagtgatgacaatttgctccaaatgattggttactgcattttatttaattctacagtcgtttacaatgatagtattgtactgtaatgtatttctgatcatttgttgaaaaagaaatcatattatgcaaaaacactaacactgcaatttacattagcaattaaactgattaaatcttgcgttatttggtg

Function

GO: NA

KEGG:

id description
ko00120 Primary bile acid biosynthesis
ko00260 Glycine, serine and threonine metabolism

RNA

RNA id representative length rna type GC content exon number start site end site
TU169071 True 351 lncRNA 0.32 1 20686697 20687047

Neighbor

gene id symbol gene type direction distance location
gabpa gabpa coding upstream 37531 20641212 ~ 20649166 (+)
sik1 LOC103352856,LOC102193135,LOC102291704,LOC101480385 coding upstream 132343 20544377 ~ 20554354 (+)
ing1 ing1 coding upstream 196188 20485226 ~ 20490509 (+)
naxd naxd,LOC102782328 coding upstream 201636 20478711 ~ 20485061 (+)
col4a2 col4a2,LOC107557913 coding upstream 215173 20389518 ~ 20471524 (+)
piga piga coding downstream 12184 20699231 ~ 20706004 (+)
asb11 LOC104950685,LOC102779537,LOC102313943 coding downstream 20194 20707241 ~ 20710700 (+)
xk xk coding downstream 37813 20724860 ~ 20734285 (+)
sytl5 sytl5 coding downstream 51745 20738792 ~ 20774655 (+)
otc otc coding downstream 122271 20809318 ~ 20813381 (+)
LOC120570651 NA non-coding upstream 7621 20667680 ~ 20679076 (+)
G125675 LOC106940919,LOC102232862,LOC103459816 non-coding upstream 34828 20649273 ~ 20651869 (+)
G125662 NA non-coding upstream 55503 20594040 ~ 20631194 (+)
G125668 NA non-coding upstream 75033 20603691 ~ 20611664 (+)
G125626 NA non-coding upstream 194538 20491661 ~ 20492159 (+)
G125718 NA non-coding downstream 25359 20712406 ~ 20713194 (+)
G125738 NA non-coding downstream 107998 20795045 ~ 20825545 (+)
G125749 NA non-coding downstream 145447 20832494 ~ 20835754 (+)
LOC120570516 NA non-coding downstream 216947 20903994 ~ 20911358 (+)
G125826 NA non-coding downstream 266690 20953737 ~ 20958039 (+)
G125627 LOC108259060,LOC105016494,LOC108266561,LOC104955100 other upstream 165423 20492178 ~ 20521274 (+)
myo16 myo16,LOC103372229 other upstream 421107 20153855 ~ 20265590 (+)
LOC120569357 LOC103369896,LOC102289365,LOC102197623,LOC101484406 other upstream 693373 19968360 ~ 19993324 (+)
igsf3 LOC103352919,LOC104967650 other upstream 1227423 19388015 ~ 19459274 (+)
tmsb4x NA other upstream 1595912 19089418 ~ 19090785 (+)
mpc2b mpc2 other downstream 166042 20853089 ~ 20858916 (+)
G125757 rpl24 other downstream 173105 20860152 ~ 20865442 (+)
sox1a LOC103372296,LOC101481640,LOC100691128 other downstream 932301 21619348 ~ 21634757 (+)
LOC120569986 LOC103372298,LOC100698342,LOC102199663,LOC102299751,LOC101469554,LOC102782232 other downstream 968079 21655126 ~ 21691804 (+)
fbxl3a fbxl3 other downstream 2043876 22730923 ~ 22738653 (+)

Expression


Co-expression Network