G127209


Basic Information

Item Value
gene id G127209
gene name NA
gene type non-coding
species eurasian perch (Perca fluviatilis)
category of species economic fish

Chromosome Information

Item Value
chromosome id NC_053123.1
NCBI id CM020920.1
chromosome length 39440604
location 26352887 ~ 26356909 (+)
genome version GENO_Pfluv_1.0_2020_eurasian_perch_Genome

Sequence

>TU171182
ACTAACCCTGATCCCTGATCCCTGCCCACTGAGCTGGTAGCTCTGTAGCTCGGAGGAGAGCCGGTCGGACCCTCTGTTCTGGCTGACTGGAGGTCAGCGGCTTCAGACAGGGAGGCCTCCTAGACCAACTGCTTTCGCAGCGCCCGGTCTCTGCCGAAGCCGCTGGCCTCCAGCAGCCTGGAGCAGAAGCTCCGACCGCCTCAGCTCCGAGCTTCAGAGCTG

Function

NR:

description
unnamed protein product

GO:

id name namespace
GO:0022412 cellular process involved in reproduction in multicellular organism biological_process
GO:0019538 protein metabolic process biological_process
GO:0007281 germ cell development biological_process
GO:0006508 proteolysis biological_process
GO:0003006 developmental process involved in reproduction biological_process

KEGG:

id description
ko04972 Pancreatic secretion
ko04974 Protein digestion and absorption
ko05164 Influenza A

RNA

RNA id representative length rna type GC content exon number start site end site
TU171182 True 222 lncRNA 0.64 2 26352887 26356909

Neighbor

gene id symbol gene type direction distance location
LOC120569747 NA coding upstream 225776 26099440 ~ 26127111 (+)
LOC120570670 NA coding upstream 256890 26086729 ~ 26095997 (+)
il1rl1 NA coding upstream 278548 26027828 ~ 26074339 (+)
LOC120569283 NA coding upstream 337072 25995584 ~ 26015815 (+)
LOC120569280 NA coding upstream 363252 25963002 ~ 25989635 (+)
ttf2 ttf2,LOC105900813,LOC105419959 coding downstream 39161 26396070 ~ 26410761 (+)
ift88 ift88 coding downstream 179044 26535953 ~ 26560881 (+)
il17d il17d coding downstream 204113 26561022 ~ 26565252 (+)
popdc2 popdc2 coding downstream 361596 26718505 ~ 26731164 (+)
wars2 wars2,LOC102792775 coding downstream 475084 26831993 ~ 26860003 (+)
G127204 NA non-coding upstream 60098 26292443 ~ 26292789 (+)
G127203 NA non-coding upstream 84786 26267885 ~ 26268101 (+)
G127095 NA non-coding upstream 254346 26098273 ~ 26098541 (+)
LOC120570231 NA non-coding upstream 268382 26081889 ~ 26084505 (+)
G127054 NA non-coding upstream 526597 25825272 ~ 25826290 (+)
G127264 NA non-coding downstream 84487 26441396 ~ 26442298 (+)
G127273 NA non-coding downstream 146650 26503559 ~ 26505543 (+)
G127270 NA non-coding downstream 153266 26510175 ~ 26518288 (+)
G127332 lats2 non-coding downstream 279322 26636231 ~ 26640460 (+)
G127333 LOC107712271,LOC107597418,LOC107724484,LOC107569193,LOC107658249 non-coding downstream 285406 26642315 ~ 26642650 (+)
G127165 LOC100691947,LOC102776592,LOC101469272,LOC102213137 other upstream 223008 26116988 ~ 26129879 (+)
cacnb4a cacnb4 other upstream 688460 25630107 ~ 25664427 (+)
fzd5 LOC104950716,LOC108238837 other upstream 1957902 24372471 ~ 24394985 (+)
sestd1 sestd1 other upstream 2054669 24277157 ~ 24298218 (+)
cwc22 cwc22 other upstream 2153052 24183949 ~ 24199835 (+)
mphosph8 mphosph8 other downstream 54568 26411477 ~ 26439285 (+)
zmym2 zmym2 other downstream 92534 26449443 ~ 26484088 (+)
LOC120569906 NA other downstream 356441 26713350 ~ 26717397 (+)
prkag3b prkag3,LOC103374929,LOC105937223,LOC107101406 other downstream 2031734 28388643 ~ 28409839 (+)
G127814 itgb5 other downstream 2671993 29028902 ~ 29041224 (+)

Expression


Co-expression Network