G170802 (zgc:194989,hist2h2l,LOC107719244,LOC108277172,LOC103356012,LOC107574861,LOC108179079)


Basic Information

Item Value
gene id G170802
gene name zgc:194989,hist2h2l,LOC107719244,LOC108277172,LOC103356012,LOC107574861,LOC108179079
gene type unknown
species eurasian perch (Perca fluviatilis)
category of species economic fish

Chromosome Information

Item Value
chromosome id NC_053127.1
NCBI id CM020924.1
chromosome length 37730433
location 34308994 ~ 34309714 (-)
genome version GENO_Pfluv_1.0_2020_eurasian_perch_Genome

Sequence

>TU231512
TTAACTTGGTAACTTGCTATGGTGCATGTGTGCAAATCAGTACCAAGGTGCAAAGGAGAGTTCCAGTTTAGTAGCACAGACTAACATTTATTAACATTTAGTTTAAACAAAATGGCAGGCTACAGTTCCAAGACATTTCGTTCTCTTTAAAAACCGGCAATGGTGCAAAAATCAAAGCAGCCTACATCCGACATATGAGGACCCGGGGATGAGGGTTTAAAGAAAGTCTTGGCGGTGATTTAGTGACCGTTGTCCCCCTGTGTCTAGACTCGGCTAAGTCTCTATTTGGAGCTGGTGTACTTGGTCACGGCCTTGGTGCCTTCAGACACGGCATGTTTGGCCAGCTCCCCGGGCAGCAGCAGGCGGACCGCGGTCTGGATCTCCCTGGAGGTGATGGTGGACCTCTTGTTGTAGTGCGCCAGGCGCGACGCTTCGCCGGCGATGCGCTCGAAGATGTCGTTGACGAAAGAGTTCATGATGCCCATGGCCTTGGAGGAGATCCCCGTGTCTGGGTGCACCTGCTTCAGCACCTTATACACATAAATGGCATAGCTTTCCTTCCTGGTCTTGCGACGCTTTTTGCCTCCTTTCTTCTGTGTTTTGGTCACGGCCTTTTTGGAGCCCTTCTTTGGCGCAGGAGCAGATTTTGCAGGATCAGGCATTTTCTCTTCGGTGTAAACGCCAGGGAAAC

Function

symbol description
hist2h2l Predicted to enable DNA binding activity. Predicted to be involved in nucleosome assembly. Located in chromatin. Is expressed in gill; heart; muscle; pleuroperitoneal region; and proliferative region. Orthologous to several human genes including H2BC21 (H2B clustered histone 21).
zgc:194989 Predicted to enable DNA binding activity and protein heterodimerization activity. Predicted to be located in chromosome and nucleus. Predicted to be part of nucleosome. Orthologous to several human genes including H2BC21 (H2B clustered histone 21).

NR:

description
PREDICTED: histone H2B 1/2

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU231512 True 691 TUCP 0.51 2 34308994 34309714

Neighbor

gene id symbol gene type direction distance location
LOC120544499 zgc:101846,LOC106525086,LOC105921220,LOC108416226 coding downstream 159 34307928 ~ 34308835 (-)
LOC120543837 NA coding downstream 8865 34284561 ~ 34300129 (-)
hspa8 hspa8,LOC103356016,LOC102792298,LOC105921217 coding downstream 26417 34278171 ~ 34282577 (-)
LOC120544757 NA coding downstream 27977 34280925 ~ 34281017 (-)
LOC120544758 NA coding downstream 29600 34279302 ~ 34279394 (-)
hyou1 hyou1,LOC102793191 coding upstream 23176 34332890 ~ 34356272 (-)
vps11 vps11,LOC102793489 coding upstream 47425 34357139 ~ 34378936 (-)
LOC120544103 NA coding upstream 70531 34380245 ~ 34410183 (-)
dlg2 dlg2,LOC103395064,LOC106603804 coding upstream 114463 34424177 ~ 34669815 (-)
sytl2a NA coding upstream 362066 34671780 ~ 34692251 (-)
G170793 NA non-coding downstream 73457 34233915 ~ 34235537 (-)
G170709 LOC104955000,LOC104935109,LOC101063545 non-coding downstream 85768 34220652 ~ 34223226 (-)
LOC120543853 NA non-coding downstream 169101 34137920 ~ 34139893 (-)
G170696 NA non-coding downstream 201191 34107514 ~ 34107803 (-)
G170679 NA non-coding downstream 755962 33552719 ~ 33553032 (-)
LOC120543660 NA non-coding upstream 102088 34411802 ~ 34413193 (-)
G170830 NA non-coding upstream 390182 34699896 ~ 34700115 (-)
G170897 NA non-coding upstream 730094 35039808 ~ 35040363 (-)
G170906 NA non-coding upstream 771525 35081239 ~ 35090028 (-)
G170919 NA non-coding upstream 799542 35109256 ~ 35109466 (-)
ntm LOC100703630,LOC102197934,LOC101488072,LOC102307721,LOC103141059 other downstream 208748 33568621 ~ 34100246 (-)
LOC120543978 fez1 other downstream 1817689 32443286 ~ 32491305 (-)
G170463 NA other downstream 2106788 32201709 ~ 32202206 (-)
G170098 NA other downstream 3350496 30957501 ~ 30958498 (-)
LOC120543892 LOC103394800 other downstream 3457940 30846998 ~ 30851054 (-)
cblb cblb other upstream 613659 34923373 ~ 35016119 (-)
LOC120575651 LOC105011014,LOC103356025,LOC103395028,LOC106603763 other upstream 1797100 36106814 ~ 36246233 (-)
LOC120575647 kirrel3,LOC106567547,LOC105011011 other upstream 2107209 36416923 ~ 36780232 (-)
LOC120544784 NA other upstream 2372386 36682100 ~ 36682165 (-)
LOC120544707 prrg3 other upstream 2686810 36996524 ~ 37062264 (-)

Expression


Co-expression Network