G69315


Basic Information

Item Value
gene id G69315
gene name NA
gene type non-coding
species eurasian perch (Perca fluviatilis)
category of species economic fish

Chromosome Information

Item Value
chromosome id NC_053117.1
NCBI id CM020914.1
chromosome length 43979800
location 43489292 ~ 43489628 (+)
genome version GENO_Pfluv_1.0_2020_eurasian_perch_Genome

Sequence

>TU92874
cccagtaccaccacagtctgatctgatcacattcatactggaagctgcccagtaccaccacagtctgatctgatcacattcatacctggaagctgcccagtaccaccacagtctgatctgaccacattcatacctggaagctgcccagtaccaccacagtctgatctgatcacatgcatacctggaagctgccctgtaccaccacagtctgatctgatcacattcatacctggaagctgcccagtaccaccacagtctgatctgatcacattcatacctggaagctgcc

Function

GO:

id name namespace
GO:0005212 structural constituent of eye lens molecular_function

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU92874 True 289 lncRNA 0.51 2 43489292 43489628

Neighbor

gene id symbol gene type direction distance location
LOC120561123 NA coding upstream 36915 43432770 ~ 43452377 (+)
LOC120560229 wdr5,LOC103397940,LOC107686885 coding upstream 833358 42644746 ~ 42655934 (+)
LOC120560195 NA coding upstream 846231 42550273 ~ 42643061 (+)
ccdc180 NA coding upstream 954414 42495285 ~ 42534878 (+)
LOC120560205 NA coding upstream 999030 42450281 ~ 42490262 (+)
LOC120561126 NA coding downstream 242814 43732442 ~ 43767127 (+)
gpsm1a NA coding downstream 279599 43769227 ~ 43775319 (+)
LOC120561432 NA coding downstream 286201 43775829 ~ 43801999 (+)
med27 med27 coding downstream 379245 43868873 ~ 43892461 (+)
LOC120560063 NA coding downstream 404103 43893731 ~ 43900338 (+)
G69307 NA non-coding upstream 80164 43408209 ~ 43409128 (+)
G69279 LOC101472590 non-coding upstream 217302 43269970 ~ 43271990 (+)
G69278 NA non-coding upstream 221543 43266915 ~ 43267749 (+)
G69277 NA non-coding upstream 223401 43263357 ~ 43265891 (+)
G68623 NA non-coding upstream 283084 43204059 ~ 43206208 (+)
G69333 NA non-coding downstream 73355 43562983 ~ 43563621 (+)
G69407 NA non-coding downstream 174995 43664623 ~ 43664864 (+)
G69411 NA non-coding downstream 184071 43673699 ~ 43674407 (+)
G69412 LOC106532130,LOC108248104,LOC101174109,LOC103370617 non-coding downstream 185160 43674788 ~ 43675996 (+)
G69413 NA non-coding downstream 186979 43676607 ~ 43677161 (+)
fhip2b LOC104934748,LOC101470392,LOC102195170,LOC102290393,LOC100711782 other upstream 83319 43383617 ~ 43405973 (+)
G69274 NA other upstream 237969 43250687 ~ 43251323 (+)
G68626 NA other upstream 326888 43032267 ~ 43162404 (+)
entr1 NA other upstream 450818 43025265 ~ 43038474 (+)
LOC120561116 LOC101485158,LOC102302930,LOC100699693,LOC106633016 other upstream 490909 42976146 ~ 42998383 (+)
G69431 NA other downstream 319997 43809625 ~ 43810963 (+)

Expression


Co-expression Network