AMCG00001477 (acoxl)


Basic Information

Item Value
gene id AMCG00001477
gene name acoxl
gene type coding
species bowfin (Amia calva)
category of species ecological fish

Chromosome Information

Item Value
chromosome id CM030143.1
NCBI id CM030143.1
chromosome length 20516281
location 5537336 ~ 5557467 (+)
genome version AmiCal1_2021_bowfin_Genome

Sequence

>AMCG00001477
ATGGATGAAGACTTGTATCATGGCCGAGACCTTATGAACAGTCGATCCCTGCAGGCCCTGATTGCTGGACTGAAGGCCTACAGCACTTGGGAAAACCTGGCCTGCTTGCAAGACTGCAGGGAGTGTACAGGAGGAATGGGGTTTATGATGGAGAACCGCATTCCTGCTTTGAAGTGCGATTCCGATGTCTTCGTGACGTTTGAAGGGGACAATGTTGTAATGCTGCAGGTCGTAGTGCGTGAACTCATGGCTCAGTACACCAAACAGTTTGAAGACAGCGCTGTGTTCGGTCACCTGAAAAACTGGACGAGTTCGGCTTCAGACAGTCTGAGAACCAGTTTCCTGGGCTTCGGCGTAGATAAGGTTGGTGATCTGGCCTTTCTGCTGAAAGCTCTGAACTACAGGGAGCGGGTGCTTCAGCGCAGCCTTGCGGCCCGGCTCTACACAAAGGTGGAGAAGAACAAGGATGAGTTTTTCGATGCCTGGAACTCCTGTCTTCATCACATAACTAGCCTGGCCCTTGCTCATATACACAGAGTGGGCACAGAATGGAAGTAA

Function

symbol description
acoxl Predicted to enable acyl-CoA oxidase activity; fatty acid binding activity; and flavin adenine dinucleotide binding activity. Predicted to be involved in fatty acid beta-oxidation using acyl-CoA oxidase and lipid homeostasis. Predicted to act upstream of or within fatty acid beta-oxidation. Predicted to be active in peroxisome. Orthologous to human ACOXL (acyl-CoA oxidase like).

NR:

description
PREDICTED: acyl-coenzyme A oxidase-like protein

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
AMCG00001477 True 558 mRNA 0.51 6 5537336 5557467

Neighbor

gene id symbol gene type direction distance location
AMCG00001476 acoxl coding upstream 35068 5491326 ~ 5502268 (+)
AMCG00001475 NA coding upstream 50881 5481284 ~ 5486455 (+)
AMCG00001478 NA coding upstream 68398 5465896 ~ 5468938 (+)
AMCG00001479 NA coding upstream 123800 5403225 ~ 5413536 (+)
AMCG00001470 NA coding upstream 286892 5249374 ~ 5250444 (+)
AMCG00001488 vip,LOC107597641,LOC107679148,LOC107655780,LOC107585469 coding downstream 262139 5819606 ~ 5826495 (+)
AMCG00001498 NA coding downstream 432795 5990262 ~ 6001627 (+)
AMCG00001497 LOC107578948,LOC107682299 coding downstream 528133 6085600 ~ 6086340 (+)
AMCG00001500 NA coding downstream 627733 6185200 ~ 6191972 (+)
AMCG00001501 NA coding downstream 636795 6194262 ~ 6198251 (+)
G158104 NA non-coding upstream 114244 5421471 ~ 5423092 (+)
G158089 NA non-coding upstream 222100 5313068 ~ 5315236 (+)
G158014 NA non-coding upstream 648984 4888114 ~ 4888352 (+)
G157985 NA non-coding upstream 662192 4872695 ~ 4875144 (+)
G157975 NA non-coding upstream 823176 4713895 ~ 4714160 (+)
G158184 NA non-coding downstream 150625 5708092 ~ 5734559 (+)
G158230 NA non-coding downstream 334579 5892046 ~ 5892246 (+)
G158332 NA non-coding downstream 839453 6396920 ~ 6398188 (+)
G158337 NA non-coding downstream 851554 6409021 ~ 6410557 (+)
G158342 NA non-coding downstream 864533 6422000 ~ 6422235 (+)
AMCG00001480 NA other upstream 154272 5366005 ~ 5383064 (+)
AMCG00001457 NA other upstream 885336 4623467 ~ 4652000 (+)
AMCG00001430 srf other upstream 1475003 4045356 ~ 4062333 (+)
AMCG00001433 NA other upstream 1513426 4022797 ~ 4023910 (+)
G157781 NA other upstream 1656557 3875209 ~ 3880779 (+)
AMCG00001486 NA other downstream 36213 5593680 ~ 5633349 (+)
AMCG00001489 NA other downstream 312508 5869975 ~ 5871430 (+)
AMCG00001493 NA other downstream 332369 5889836 ~ 5900998 (+)
AMCG00001509 sf3b5 other downstream 836636 6394103 ~ 6395960 (+)
G158478 NA other downstream 1317301 6874768 ~ 6876578 (+)

Expression


Co-expression Network