AMCG00001767 (csmd1,LOC107565078,LOC107564890)


Basic Information

Item Value
gene id AMCG00001767
gene name csmd1,LOC107565078,LOC107564890
gene type coding
species bowfin (Amia calva)
category of species ecological fish

Chromosome Information

Item Value
chromosome id CM030143.1
NCBI id CM030143.1
chromosome length 20516281
location 14944806 ~ 14949138 (+)
genome version AmiCal1_2021_bowfin_Genome

Sequence

>AMCG00001767
TTACCGAGTCACACGTGTGGTAATCCCGGAGTGATAGCCAAAGGAGTGGTCCATGGATCACGCTATAATATCGGAGACAAAATCCGATACAGCTGTGTGACGGGCTATGTGTTGGAAGGACACTCGGTTCTGACATGCATCGTGAGTCCCGGCAGTGGAGCATCATGGGATTTCCCTGCTCCATTTTGTCGAGCTGAAGGAGCTTGTGGTGGCACATTAAGAGGGACAACGGGGACGATATCTAGTCCACACTTTCCTTCAGAGTATGAGAACAACGCTGATTGCACATGGAGCATCCTGGCAGAACCAGGAGACACCATAGCTTTGGTCTTCACCGACTTTCAGCTTGAAGACAGATACGACTTTCTCGAGATCAGTGGAACAGAGGCGCCGTCAATA

Function

symbol description
csmd1 Predicted to act upstream of or within several processes, including learning or memory; mammary gland branching involved in pregnancy; and reproductive structure development. Predicted to be integral component of membrane.

NR:

description
PREDICTED: CUB and sushi domain-containing protein 1 isoform X1

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
AMCG00001767 True 399 mRNA 0.50 2 14944806 14949138

Neighbor

gene id symbol gene type direction distance location
AMCG00001757 csmd1,LOC107565077,LOC107717843,LOC107564890 coding upstream 146871 14721926 ~ 14797935 (+)
AMCG00001753 NA coding upstream 322203 14605507 ~ 14622603 (+)
AMCG00001750 NA coding upstream 375801 14544548 ~ 14569005 (+)
AMCG00001749 ick,LOC106612589,LOC102778244 coding upstream 400359 14533876 ~ 14544447 (+)
AMCG00001747 NA coding upstream 420538 14520040 ~ 14524268 (+)
AMCG00001766 LOC106589815 coding downstream 67094 15016232 ~ 15118185 (+)
AMCG00001758 NA coding downstream 314960 15264098 ~ 15266184 (+)
AMCG00001759 rps6ka2,LOC107750746,LOC107717821,LOC107702677,LOC105021344 coding downstream 336726 15285864 ~ 15325738 (+)
AMCG00001761 NA coding downstream 438908 15388046 ~ 15392676 (+)
AMCG00001770 NA coding downstream 544109 15493247 ~ 15501705 (+)
G160144 NA non-coding upstream 243350 14701134 ~ 14701456 (+)
G160129 NA non-coding upstream 312316 14629303 ~ 14632490 (+)
G160116 NA non-coding upstream 381437 14558766 ~ 14563369 (+)
G160107 NA non-coding upstream 418298 14525737 ~ 14526508 (+)
G160036 NA non-coding upstream 638546 14306025 ~ 14306260 (+)
G160200 NA non-coding downstream 453147 15402285 ~ 15417554 (+)
G160375 NA non-coding downstream 879638 15828776 ~ 15829766 (+)
G160463 NA non-coding downstream 1165206 16114344 ~ 16114699 (+)
G160464 NA non-coding downstream 1168067 16117205 ~ 16119266 (+)
G160542 tubb4b,LOC106575097,LOC105893757 non-coding downstream 1327668 16276806 ~ 16278054 (+)
G160026 NA other upstream 674616 14269615 ~ 14270190 (+)
AMCG00001691 NA other upstream 2611106 12329979 ~ 12333700 (+)
AMCG00001645 NA other upstream 4186948 10747489 ~ 10757858 (+)
AMCG00001643 spred2 other upstream 4266952 10655187 ~ 10677854 (+)
AMCG00001630 NA other upstream 4784980 10157734 ~ 10159826 (+)
AMCG00001760 mpc1,LOC107725004,LOC106589821,LOC107693783 other downstream 382482 15331620 ~ 15334580 (+)
AMCG00001762 NA other downstream 483199 15432337 ~ 15439031 (+)
AMCG00001814 ryr2,LOC106456445,LOC108410403,LOC106906861,LOC101062804,LOC103129799 other downstream 1288124 16237262 ~ 16377860 (+)
AMCG00001841 NA other downstream 2230456 17179594 ~ 17182601 (+)
AMCG00001846 NA other downstream 2468213 17417351 ~ 17462934 (+)

Expression


Co-expression Network