AMCG00002273


Basic Information

Item Value
gene id AMCG00002273
gene name NA
gene type coding
species bowfin (Amia calva)
category of species ecological fish

Chromosome Information

Item Value
chromosome id CM030136.1
NCBI id CM030136.1
chromosome length 27394605
location 9873347 ~ 9874094 (+)
genome version AmiCal1_2021_bowfin_Genome

Sequence

>AMCG00002273
GCCACAGGAGCTGGGGGGATGAACCGAGAAGATGGCCCCGGGAAGTCGCCCGAAGAGATGTACATTCAGCAGAAAGTTCGCGTCTTGCTCATGCTGAAGAAGATGGGGTCCAATTTGACACCTAATGAGGAACAGTTTCTCCAGAACTATGCTGGTGTGGTGCACAGCCAGATGAGTCAACTCCCCCAGCACCCCATCGACCAGGGTAAGGGCACTGCTCTCGTCTGA

Function

GO:

id name namespace
GO:0030178 negative regulation of Wnt signaling pathway biological_process
GO:0009952 anterior/posterior pattern specification biological_process
GO:0001658 branching involved in ureteric bud morphogenesis biological_process
GO:0005829 cytosol cellular_component
GO:0005634 nucleus cellular_component
GO:0008013 beta-catenin binding molecular_function

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
AMCG00002273 True 228 mRNA 0.55 2 9873347 9874094

Neighbor

gene id symbol gene type direction distance location
AMCG00002274 lzic,LOC107708836,LOC107586557,LOC107718820,LOC107681991,LOC107695771 coding upstream 10258 9853550 ~ 9863089 (+)
AMCG00002266 NA coding upstream 217589 9654733 ~ 9655758 (+)
AMCG00002264 tardbp,LOC107586522,LOC107716231,LOC107695779,LOC107570713,LOC107681961 coding upstream 248653 9619457 ~ 9624694 (+)
AMCG00002262 NA coding upstream 588914 9253274 ~ 9284433 (+)
AMCG00002258 NA coding upstream 687784 9173970 ~ 9185563 (+)
AMCG00002278 clstn1 coding downstream 76912 9951006 ~ 9971665 (+)
AMCG00002287 NA coding downstream 427213 10301307 ~ 10304361 (+)
AMCG00002290 NA coding downstream 492055 10366149 ~ 10376762 (+)
AMCG00002289 NA coding downstream 510331 10384425 ~ 10392661 (+)
AMCG00002291 eno1,LOC107716106,LOC107703060,LOC107591100,LOC104965722,LOC108434336 coding downstream 525567 10399661 ~ 10425473 (+)
G122119 NA non-coding upstream 42669 9829754 ~ 9830678 (+)
G122086 NA non-coding upstream 114286 9693716 ~ 9759061 (+)
G122063 NA non-coding upstream 244514 9628598 ~ 9628833 (+)
G122058 NA non-coding upstream 247126 9625244 ~ 9626221 (+)
G121999 NA non-coding upstream 310756 9542615 ~ 9562591 (+)
G122198 NA non-coding downstream 205653 10079747 ~ 10132200 (+)
G122236 NA non-coding downstream 449435 10323529 ~ 10326651 (+)
G122328 her9,LOC107687478,LOC107716081,LOC107593950,LOC107703052,LOC107737700,LOC107591146 non-coding downstream 996679 10870773 ~ 10927943 (+)
G122389 NA non-coding downstream 1460837 11334931 ~ 11348638 (+)
G122417 NA non-coding downstream 1583550 11457644 ~ 11470525 (+)
AMCG00002272 NA other upstream 22035 9844205 ~ 9851312 (+)
AMCG00002245 NA other upstream 1080869 8738771 ~ 8792478 (+)
AMCG00002215 NA other upstream 2462117 7393800 ~ 7411230 (+)
AMCG00002190 acot7 other upstream 3270739 6586654 ~ 6602608 (+)
AMCG00002152 NA other upstream 4646691 5218830 ~ 5226656 (+)
AMCG00002294 rere other downstream 693818 10567912 ~ 10604839 (+)
AMCG00002296 NA other downstream 840705 10714799 ~ 10753893 (+)
AMCG00002310 NA other downstream 1483458 11357552 ~ 11359840 (+)
AMCG00002311 ttll10 other downstream 1491520 11365614 ~ 11379568 (+)
G122482 NA other downstream 1754918 11629012 ~ 11630892 (+)

Expression


Co-expression Network