G3496


Basic Information

Item Value
gene id G3496
gene name NA
gene type non-coding
species bowfin (Amia calva)
category of species ecological fish

Chromosome Information

Item Value
chromosome id CM030121.1
NCBI id CM030121.1
chromosome length 57050121
location 19425007 ~ 19425344 (+)
genome version AmiCal1_2021_bowfin_Genome

Sequence

>TU4235
ccttagtcagggaggtgagcaagaacccgatggtcactctgacagagctccagcatgtctctgtggagagaggagaaccttccagaagaacaaccatctctgcagcactccaccaatcaagcctgtatggtagagtggccagatggaagccactcctcagtaaaaggcacatgacagctgcctggagtttgccaaaaggcacctgaaggactctcagaccatgataaacaaaattctctggtctgatgaaacaaagattgaactctttggcctgaatggcaagcgtcatgtctggaggaaaccaggcaccgctcatcacctggccaataccatcccta

Function

GO: NA

KEGG:

id description
ko00513 Various types of N-glycan biosynthesis

RNA

RNA id representative length rna type GC content exon number start site end site
TU4235 True 338 lncRNA 0.51 1 19425007 19425344

Neighbor

gene id symbol gene type direction distance location
AMCG00003815 pcmt1 coding upstream 244495 19168766 ~ 19180512 (+)
AMCG00003816 NA coding upstream 286807 19132983 ~ 19138200 (+)
AMCG00003812 tab2 coding upstream 340054 19073792 ~ 19084953 (+)
AMCG00003814 cdk19 coding upstream 393260 19017005 ~ 19031747 (+)
AMCG00003813 cdk19,LOC103371529 coding upstream 421149 19003056 ~ 19003858 (+)
AMCG00003826 NA coding downstream 23528 19448872 ~ 19450273 (+)
AMCG00003827 NA coding downstream 205126 19630470 ~ 19631447 (+)
AMCG00003832 NA coding downstream 507830 19933174 ~ 19943837 (+)
AMCG00003833 NA coding downstream 518666 19944010 ~ 19945017 (+)
AMCG00003835 NA coding downstream 707429 20132773 ~ 20133355 (+)
G3391 NA non-coding upstream 338292 19084971 ~ 19086715 (+)
G3375 NA non-coding upstream 453883 18951252 ~ 18971124 (+)
G3373 NA non-coding upstream 474753 18949754 ~ 18950254 (+)
G3370 NA non-coding upstream 478876 18945582 ~ 18946131 (+)
G3269 NA non-coding upstream 879469 18544984 ~ 18545538 (+)
G3534 NA non-coding downstream 287459 19712803 ~ 19713057 (+)
G3536 NA non-coding downstream 299983 19725327 ~ 19725709 (+)
G3548 NA non-coding downstream 471766 19897110 ~ 19897535 (+)
G3549 NA non-coding downstream 472241 19897585 ~ 19897910 (+)
G3550 NA non-coding downstream 472922 19898266 ~ 19898543 (+)
AMCG00003828 ctgf,ctgfa,moxd1,LOC106571301,LOC107683930,LOC106571350 other upstream 27321 19271965 ~ 19397686 (+)
G3108 NA other upstream 1272693 18146660 ~ 18152314 (+)
AMCG00003779 ctsb,catb,LOC107381178 other upstream 1282374 18131919 ~ 18142633 (+)
G3047 NA other upstream 1741019 17681817 ~ 17683988 (+)
AMCG00003744 NA other upstream 2382413 17032570 ~ 17042594 (+)
G3751 NA other downstream 2123857 21549201 ~ 21549533 (+)
G3771 NA other downstream 2320506 21745850 ~ 21760630 (+)
AMCG00003853 NA other downstream 2465179 21890523 ~ 21901865 (+)
G3799 med23 other downstream 2497292 21922636 ~ 21923787 (+)
AMCG00003874 NA other downstream 3257672 22683016 ~ 22769227 (+)

Expression


Co-expression Network