AMCG00009280 (spsb4,spsb4a,LOC108267127,LOC103021520,LOC108440634,LOC107743001)


Basic Information

Item Value
gene id AMCG00009280
gene name spsb4,spsb4a,LOC108267127,LOC103021520,LOC108440634,LOC107743001
gene type coding
species bowfin (Amia calva)
category of species ecological fish

Chromosome Information

Item Value
chromosome id CM030126.1
NCBI id CM030126.1
chromosome length 46242406
location 31473753 ~ 31477141 (-)
genome version AmiCal1_2021_bowfin_Genome

Sequence

>AMCG00009280
ATGGGCCAGAAAATCTCAGGGAGTATAAAGTCTGTGGATGTGCGGGAGCCTGCGTACCGGCCGGTGAAACGGGAGCTGCGGGGTCCTGACTTTTGCAAGCCTGCCCGCCTCGACATGTTGCTGGACATGCCCTCCGCCACCCTGGAGGTCCAGCTCAAACACGCCTGGAACAATGAAGATCGCTCGCTCAACATTTTTGTCAAGGAGGACGATAAACTAACCTTCCACAGGCACCCCGTGGCCCAGAGTACAGACTGCATCAGGGGCCGGGTGGGCTACACCAGAGGCCTGCATGTGTGGCAGATCCACTGGCCCACCAGGCAGAGGGGGACGCACGCGGTGGTGGGGGTGGCGACCTCAGAGGCCCCACTTCACTCGGTGGGGTACACCTCCCTGGTGGGCAGCAATTGCGAGTCGTGGGGTTGGGACCTGGGACGCAACAAACTGTACCACAACAGCAAGAACCAACCAGGAGTTACGTACCCTGTGTTTTTGGAACCAGACGAGTCTTTCGTGCTGCCAGATTCTTTGTTGGTAGTGCTAGACATGGACGAGGGGACTCTGAGCTTTATAGTGGATGGGCAGTACCTGGGAGTGGCCTTCAGGGGACTCAAAGGGAAAAAACTCCATCCTGTAGTGAGTGCGGTGTGGGGGCACTGTGAGATCACGATGAGATACGTCAACGGACTTGATCTCTATGCCCCTGCTAGGCTGGAGTTTGACTTCTACTTTTGTTGA

Function

symbol description
spsb4a Predicted to be involved in proteasome-mediated ubiquitin-dependent protein catabolic process. Predicted to be part of SCF ubiquitin ligase complex. Is expressed in brain; head; and reproductive system. Orthologous to human SPSB4 (splA/ryanodine receptor domain and SOCS box containing 4).
spsb4 Enables ubiquitin ligase-substrate adaptor activity. Involved in cellular protein metabolic process; positive regulation of protein polyubiquitination; and regulation of circadian rhythm. Located in cytosol.

NR:

description
PREDICTED: SPRY domain-containing SOCS box protein 4-like

GO:

id name namespace
GO:0035556 intracellular signal transduction biological_process

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
AMCG00009280 True 738 mRNA 0.57 2 31473753 31477141

Neighbor

gene id symbol gene type direction distance location
AMCG00009274 copb2,LOC106599054,LOC105021140 coding downstream 324953 31136569 ~ 31148800 (-)
AMCG00009272 foxl2,LOC101448029,LOC100136214,LOC106613173 coding downstream 406729 31066530 ~ 31067024 (-)
AMCG00009271 pik3cb,LOC106581359,LOC106613172 coding downstream 453945 30987124 ~ 31019808 (-)
AMCG00009270 NA coding downstream 502895 30947298 ~ 30970858 (-)
AMCG00009263 cab39 coding downstream 556131 30906868 ~ 30917622 (-)
AMCG00009279 slc25a36,slc25a36a,LOC107706334,LOC107668959,LOC108440632,LOC107694658 coding upstream 65521 31542662 ~ 31563060 (-)
AMCG00009282 epha4,LOC108440631 coding upstream 309628 31786769 ~ 31809463 (-)
AMCG00009285 pax3 coding upstream 405488 31882629 ~ 31900424 (-)
AMCG00009286 pax3 coding upstream 429585 31906726 ~ 31909194 (-)
AMCG00009287 NA coding upstream 442021 31919162 ~ 31919851 (-)
G55861 NA non-coding downstream 657662 30809576 ~ 30816091 (-)
G55760 NA non-coding downstream 818732 30652912 ~ 30655021 (-)
G55722 NA non-coding downstream 981773 30491238 ~ 30491980 (-)
G55703 NA non-coding downstream 990380 30480779 ~ 30483373 (-)
G55648 NA non-coding downstream 1237358 30236159 ~ 30236395 (-)
G55975 NA non-coding upstream 438027 31915168 ~ 31915373 (-)
G55991 NA non-coding upstream 473281 31950422 ~ 31950673 (-)
G56012 NA non-coding upstream 520936 31998077 ~ 32031970 (-)
G56163 NA non-coding upstream 1323394 32800535 ~ 32800895 (-)
G56185 NA non-coding upstream 1366954 32844095 ~ 32844336 (-)
AMCG00009275 NA other downstream 288787 31150912 ~ 31184966 (-)
AMCG00009269 NA other downstream 487758 30972953 ~ 30985995 (-)
G55881 NA other downstream 526542 30944367 ~ 30947211 (-)
G55878 NA other downstream 536502 30934564 ~ 30937251 (-)
AMCG00009265 NA other downstream 816141 30599474 ~ 30657612 (-)
AMCG00009332 NA other upstream 2530462 34007603 ~ 34026160 (-)
AMCG00009333 NA other upstream 2564935 34042076 ~ 34050737 (-)
AMCG00009342 kcnab1 other upstream 2750133 34227274 ~ 34274084 (-)
G56438 kcnab1a,kcnab1,LOC107671078,LOC107675612,LOC107566585,LOC108263953 other upstream 2762343 34239484 ~ 34316008 (-)
AMCG00009347 gmps other upstream 2857120 34334261 ~ 34362341 (-)

Expression


Co-expression Network