AMCG00010948



Basic Information


Item Value
gene id AMCG00010948
gene name NA
gene type coding
species bowfin (Amia calva)
category of species ecological fish

Chromosome Information


Item Value
chromosome id CM030133.1
NCBI id CM030133.1
chromosome length 32682731
location 5373859 ~ 5383129 (-)
genome version AmiCal1_2021_bowfin_Genome

Sequence


>AMCG00010948
ATGGGCGCTCGGAGCTCTGTGCGGTTTGTGTGCCGCCTTTGTTTGGGCAGTGTGGCGCTCGGAGGGAAAGCCATCAGCAGGGCCGCCATGAGTGAGGGACCCCGCTGCCCTCGCTGTCTCCAGCCAGTCTGCCGCAACATCTGGATCTCACATCAGGCAGGACTCCCGGAGGAGGGGCGCGGGGGGGAGGAGGTTCTGTACCCATAA

Function


GO:

id name namespace
GO:0050878 regulation of body fluid levels biological_process
GO:0007599 hemostasis biological_process

KEGG:

id description
ko04512 ECM-receptor interaction

RNA


RNA id representative length rna type GC content exon number start site end site
AMCG00010948 True 207 mRNA 0.65 2 5373859 5383129

Neighbor


gene id symbol gene type direction distance location
AMCG00010945 id3 coding downstream 18297 5353943 ~ 5355562 (-)
AMCG00010947 NA coding downstream 26492 5335846 ~ 5347367 (-)
AMCG00010944 NA coding downstream 170228 5175899 ~ 5203631 (-)
AMCG00010938 dhdds,LOC107564097,LOC104959484,LOC104959477 coding downstream 224598 5141224 ~ 5149261 (-)
AMCG00010940 NA coding downstream 270462 5096591 ~ 5103397 (-)
AMCG00010949 NA coding upstream 17160 5400289 ~ 5410795 (-)
AMCG00010950 NA coding upstream 32403 5415532 ~ 5431128 (-)
AMCG00010953 ythdf2,LOC107654833,LOC107697702,LOC107721611 coding upstream 83204 5466333 ~ 5478561 (-)
AMCG00010952 NA coding upstream 99207 5482336 ~ 5489882 (-)
AMCG00010955 qki,LOC107721620,LOC107697705,LOC107590898,LOC106922399 coding upstream 237166 5620295 ~ 5625529 (-)
G103309 NA non-coding downstream 39602 5331732 ~ 5334257 (-)
G103149 NA non-coding downstream 948287 4425354 ~ 4425572 (-)
G103095 NA non-coding downstream 1221111 4152518 ~ 4152748 (-)
G103094 NA non-coding downstream 1222942 4150499 ~ 4150917 (-)
G103087 NA non-coding downstream 1234222 4138620 ~ 4139637 (-)
G103362 NA non-coding upstream 175548 5558677 ~ 5615853 (-)
G103473 NA non-coding upstream 1001352 6384481 ~ 6386604 (-)
G103503 NA non-coding upstream 1130734 6513863 ~ 6514123 (-)
G103539 NA non-coding upstream 1240952 6624081 ~ 6627452 (-)
G103556 NA non-coding upstream 1372164 6755293 ~ 6762139 (-)
AMCG00010946 NA other downstream 48435 5284330 ~ 5325424 (-)
AMCG00010939 NA other downstream 233350 5134053 ~ 5140509 (-)
AMCG00010937 NA other downstream 244718 5115715 ~ 5129141 (-)
AMCG00010925 srsf10,LOC108426370,LOC101486875 other downstream 723453 4642652 ~ 4650406 (-)
G103112 NA other downstream 1187885 4169793 ~ 4185974 (-)
G103395 NA other upstream 321641 5704770 ~ 5748564 (-)
AMCG00010966 NA other upstream 582004 5965133 ~ 5974307 (-)
AMCG00010988 NA other upstream 1245441 6628570 ~ 6644723 (-)
G103832 NA other upstream 2555008 7938137 ~ 8027031 (-)
AMCG00011051 NA other upstream 3436422 8819551 ~ 8864051 (-)

Expression



Co-expression Network