G46712 (pacsin1a,pacsin1b,LOC108427734,LOC106566012,LOC107587581)


Basic Information

Item Value
gene id G46712
gene name pacsin1a,pacsin1b,LOC108427734,LOC106566012,LOC107587581
gene type non-coding
species bowfin (Amia calva)
category of species ecological fish

Chromosome Information

Item Value
chromosome id CM030125.1
NCBI id CM030125.1
chromosome length 49972098
location 42557785 ~ 42558015 (-)
genome version AmiCal1_2021_bowfin_Genome

Sequence

>TU58231
TCTTTGAGTTTCTTGGCCCAGGGCTTCTGTGCTTTTCTGAAGCCGTCCTCAGCCTCCTTGGTCTCCTTGAAGCCACCCATCATCTGCTTGTGATAGGCATCTTTCTGCCAGTTCTTGACCTTCTCGAAGTCCTCAGTGAGCAGACCGTTCTTCACCTCCTGGTGTAACTCGCTCACCTTGTCCGCCTCGTTCATCATGGCCAACCAGGCGCGCTCCAGAGTGCCATACTGG

Function

symbol description
pacsin1a Predicted to enable phospholipid binding activity. Predicted to be involved in several processes, including plasma membrane tubulation; positive regulation of dendrite development; and regulation of endocytosis. Predicted to act upstream of or within actin filament organization and neuron development. Predicted to be located in several cellular components, including cytoplasmic vesicle membrane; cytosol; and ruffle membrane. Predicted to be active in endosome and plasma membrane. Is expressed in nervous system. Orthologous to human PACSIN1 (protein kinase C and casein kinase substrate in neurons 1).
pacsin1b Predicted to enable phospholipid binding activity. Acts upstream of or within auditory receptor cell stereocilium organization and cilium assembly. Predicted to be located in several cellular components, including cytoplasmic vesicle membrane; cytosol; and ruffle membrane. Predicted to be active in endosome and plasma membrane. Is expressed in nervous system; post-vent region; presumptive neural retina; and trunk. Orthologous to human PACSIN1 (protein kinase C and casein kinase substrate in neurons 1).

NR:

description
Zgc:109968

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU58231 True 231 lncRNA 0.55 1 42557785 42558015

Neighbor

gene id symbol gene type direction distance location
AMCG00013775 rps10,LOC107595410 coding downstream 58089 42496085 ~ 42499696 (-)
AMCG00013772 NA coding downstream 82366 42468731 ~ 42475419 (-)
AMCG00013767 LOC102199361,LOC101471251,LOC102312415 coding downstream 236179 42319461 ~ 42321606 (-)
AMCG00013768 LOC106572369,LOC106566015,LOC103467650 coding downstream 320352 42233455 ~ 42237433 (-)
AMCG00013765 LOC106567287,LOC106572369 coding downstream 380079 42171327 ~ 42177706 (-)
AMCG00013779 NA coding upstream 25804 42583819 ~ 42597809 (-)
AMCG00013778 cunh6orf106,LOC107696455,LOC107724532,LOC107666165,LOC107595408,LOC107744375 coding upstream 86515 42644530 ~ 42655006 (-)
AMCG00013781 taf11,LOC107673466,LOC107554211 coding upstream 137822 42695837 ~ 42699033 (-)
AMCG00013784 NA coding upstream 265123 42823138 ~ 42832422 (-)
AMCG00013790 timm17a coding upstream 389067 42947082 ~ 42953954 (-)
G46711 NA non-coding downstream 2879 42554617 ~ 42554906 (-)
G46708 NA non-coding downstream 63222 42494016 ~ 42494563 (-)
G46666 NA non-coding downstream 594863 41940434 ~ 41962922 (-)
G46630 NA non-coding downstream 769246 41781442 ~ 41788539 (-)
G46565 NA non-coding downstream 1080124 41467022 ~ 41477661 (-)
G46713 NA non-coding upstream 4625 42562640 ~ 42563406 (-)
G46714 NA non-coding upstream 6515 42564530 ~ 42569885 (-)
G46731 NA non-coding upstream 128694 42686709 ~ 42686979 (-)
G46732 NA non-coding upstream 131073 42689088 ~ 42690442 (-)
G46733 NA non-coding upstream 134315 42692330 ~ 42692661 (-)
AMCG00013773 NA other downstream 102027 42428777 ~ 42455758 (-)
AMCG00013732 NA other downstream 1920557 40618343 ~ 40637228 (-)
G46423 NA other downstream 1949257 40603601 ~ 40608528 (-)
G46418 NA other downstream 1970393 40586816 ~ 40587392 (-)
AMCG00013730 NA other downstream 2129160 40386061 ~ 40428625 (-)
G46742 NA other upstream 141491 42699506 ~ 42701068 (-)
AMCG00013820 tmem167b other upstream 1051267 43609282 ~ 43614579 (-)
AMCG00013846 NA other upstream 2780844 45338859 ~ 45344015 (-)
G47261 NA other upstream 3065223 45623238 ~ 45623895 (-)
AMCG00013882 cry4,LOC108413014 other upstream 3361621 45919636 ~ 45928309 (-)

Expression


Co-expression Network