AMCG00019882



Basic Information


Item Value
gene id AMCG00019882
gene name NA
gene type coding
species bowfin (Amia calva)
category of species ecological fish

Chromosome Information


Item Value
chromosome id CM030127.1
NCBI id CM030127.1
chromosome length 42978078
location 869061 ~ 870896 (-)
genome version AmiCal1_2021_bowfin_Genome

Sequence


>AMCG00019882
ATGTCAGGAACGAGTGCCGATATCTCCCTGGTGCACTGGAAGCAGCAGTGGCTGGAGAACGGCACCCTGTACTTCCATGTGTCGATGAGCAGCGCAGAGCAGCTGTCGCAGGTCACCGAGCCCACGGTGCGCGAGCCCTCGGAGATCGTGGACGAGCAGCTGCACATCCTCCACATATCCGTCATGGTGGTGCCAGGGCTGCTGAGTGAGTAG

Function


GO: NA

KEGG:

id description
ko04974 Protein digestion and absorption

RNA


RNA id representative length rna type GC content exon number start site end site
AMCG00019882 True 213 mRNA 0.61 2 869061 870896

Neighbor


gene id symbol gene type direction distance location
AMCG00019881 LOC106563268 coding downstream 275665 582350 ~ 593396 (-)
AMCG00019878 NA coding downstream 387540 455460 ~ 481521 (-)
AMCG00019875 NA coding downstream 628928 235518 ~ 240133 (-)
AMCG00019883 NA coding upstream 74002 944898 ~ 945889 (-)
AMCG00019887 brinp1 coding upstream 1003664 1874560 ~ 1889869 (-)
AMCG00019888 brinp1,LOC107597955,LOC106563266 coding upstream 1042545 1913441 ~ 1920755 (-)
AMCG00019889 NA coding upstream 1234934 2105830 ~ 2135939 (-)
AMCG00019890 LOC107731024,LOC108423692,LOC107665022,LOC108255392,LOC107595531 coding upstream 1289282 2160178 ~ 2185195 (-)
G59324 NA non-coding downstream 422193 445596 ~ 446868 (-)
G59322 NA non-coding downstream 486206 382652 ~ 382855 (-)
G59283 NA non-coding downstream 701038 167758 ~ 168023 (-)
G59280 NA non-coding downstream 769967 96833 ~ 99094 (-)
G59362 NA non-coding upstream 61413 932309 ~ 958515 (-)
G59388 NA non-coding upstream 393598 1264494 ~ 1264734 (-)
G59390 NA non-coding upstream 413529 1284425 ~ 1284745 (-)
G59395 NA non-coding upstream 476350 1347246 ~ 1347479 (-)
G59396 NA non-coding upstream 518449 1389345 ~ 1397225 (-)
AMCG00019880 NA other downstream 296234 535831 ~ 572827 (-)
G59408 LOC107374630,LOC108230875,LOC104924185,LOC105913012,LOC101063574 other upstream 714023 1584919 ~ 1586000 (-)
G59505 NA other upstream 1453392 2324288 ~ 2327415 (-)
G59530 NA other upstream 1584015 2454911 ~ 2480799 (-)
G59545 NA other upstream 1624003 2494899 ~ 2507020 (-)
G59712 NA other upstream 2160960 3031856 ~ 3034335 (-)

Expression



Co-expression Network