AMCG00020651


Basic Information

Item Value
gene id AMCG00020651
gene name NA
gene type coding
species bowfin (Amia calva)
category of species ecological fish

Chromosome Information

Item Value
chromosome id CM030127.1
NCBI id CM030127.1
chromosome length 42978078
location 27752194 ~ 27786025 (-)
genome version AmiCal1_2021_bowfin_Genome

Sequence

>AMCG00020651
ATGACGGCACAACGGGGCTCCTGTGTTGCCGACAATGTGGACGTTCTGCTGGACCAGAAACAAGTGACCAACAACTGTGTAGGAACTACAGTGATGCGAATGACTGCCTACGACGCTGACGACCCCAACACTGATAACGCCGTGCTGAGATACAACATCGTCAAACAGACGCCAGACCAACCCTCGCCAAACATGTTCTACATTGACCCTGAAAAGGGGGACATCGTCACGGTGGTGTCCCCTGCGCTGCTGGACAGAGAGCTTTGCACAGAGAAGCTGTTTAAGTCTTGTTGA

Function

GO:

id name namespace
GO:0006091 generation of precursor metabolites and energy biological_process

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
AMCG00020651 True 294 mRNA 0.53 3 27752194 27786025

Neighbor

gene id symbol gene type direction distance location
AMCG00020650 NA coding downstream 40490 27599214 ~ 27711704 (-)
AMCG00020649 NA coding downstream 228646 27522624 ~ 27523548 (-)
AMCG00020646 zgc:173742,LOC108415671,LOC107553995,LOC107684664,LOC107749320,LOC108264272 coding downstream 277462 27435669 ~ 27474732 (-)
AMCG00020645 zgc:173742,LOC107684664,LOC107749320,LOC107553995,LOC108415671 coding downstream 326717 27421048 ~ 27425477 (-)
AMCG00020643 si:dkey-246g23.2,LOC107684666,LOC107749300,LOC107553994,LOC107670153,LOC107738383 coding downstream 344082 27406955 ~ 27408112 (-)
AMCG00020652 NA coding upstream 9231 27795256 ~ 27857618 (-)
AMCG00020653 NA coding upstream 77450 27863475 ~ 28035409 (-)
AMCG00020658 NA coding upstream 351205 28137230 ~ 28147847 (-)
AMCG00020659 gpib,LOC108428767,LOC100196524,LOC103130839 coding upstream 464848 28250873 ~ 28265191 (-)
AMCG00020662 NA coding upstream 542960 28328985 ~ 28342177 (-)
G64745 NA non-coding downstream 331548 27420366 ~ 27420646 (-)
G64708 NA non-coding downstream 515872 27236083 ~ 27236322 (-)
G64632 NA non-coding downstream 1006371 26745549 ~ 26745823 (-)
G64630 NA non-coding downstream 1019906 26731435 ~ 26732288 (-)
G64629 NA non-coding downstream 1022083 26729855 ~ 26730111 (-)
G64847 NA non-coding upstream 530744 28316769 ~ 28323164 (-)
G64886 NA non-coding upstream 1071964 28857989 ~ 28858354 (-)
G64912 NA non-coding upstream 1210367 28996392 ~ 29001633 (-)
G64991 LOC103376870 non-coding upstream 1473532 29259557 ~ 29314059 (-)
G65023 NA non-coding upstream 2099576 29885601 ~ 29885899 (-)
AMCG00020639 LOC107583916 other downstream 502518 27246014 ~ 27249676 (-)
AMCG00020613 NA other downstream 1803851 25934901 ~ 25948343 (-)
G64470 NA other downstream 1833564 25898428 ~ 25918630 (-)
AMCG00020614 NA other downstream 1846596 25886050 ~ 25905598 (-)
AMCG00020604 NA other downstream 2036737 25687275 ~ 25715457 (-)
AMCG00020657 NA other upstream 375577 28161602 ~ 28239074 (-)
G64811 NA other upstream 440510 28226535 ~ 28229647 (-)
AMCG00020661 ss18l2 other upstream 539012 28325037 ~ 28328312 (-)
G64882 NA other upstream 1002555 28788580 ~ 28796956 (-)
G65000 NA other upstream 1595290 29381315 ~ 29405636 (-)

Expression


Co-expression Network