Fish Transcriptome and Expression Database

Home /
Search /
- Gene
- RNA
- Bioproject
Expression /
Analysis /
- Coding ability prediction
- Expression count
- Visual Omics
Tools /
- Neighbor
- BLAST
Statistics /
Download /
Help

model fish

XLOC_006558

Basic Information

Item	Value
gene id	XLOC_006558
gene name	NA
gene type	non-coding
species	zebrafish (Danio rerio)
category of species	model fish

Chromosome Information

Item	Value
chromosome id	NC_007124.7
NCBI id	CM002897.2
chromosome length	52186027
location	19338477 ~ 19339436 (-)
genome version	GRCz11_2017_zebrafish_Genome

Sequence

>TCONS_00013476
CGCCAATGAAGAAACGCGGGAGAGAGCGGCAGGGCGCTATCATCATCAGTTATCAGGATTCACCATGCTGTTGCTGGTTTCAAGGTGACATGTCTTCAGGGCTGGATACACCGTCCAAGATGACAAGGAGTCTAACCGGATATGAGGAGATATGCAGCTGTCTGTCCATGCTGATCCCTGCGCTGACCAGGAGGTAAAGGGAACTTCAACAGCTGCTCTTAGAAAG

Function

GO: NA

KEGG:

id	description
ko03230	Viral genome structure
ko05164	Influenza A
ko03200	Viral proteins

RNA

RNA id	representative	length	rna type	GC content	exon number	start site	end site
TCONS_00013476	True	226	lncRNA	0.51	2	19338477	19339436

Notice the +/- strand.
Display format: symbol/gene id: RNA id. (Except when gene id is similar to RNA id.)
You can browse transcripts by dragging.
A more detailed transcript can be viewed by the zoom button in the upper right corner.

Neighbor

gene id	symbol	gene type	direction	distance	location
XLOC_006557	NA	coding	downstream	61145	19276173 ~ 19277332 (-)
XLOC_006556	NA	coding	downstream	321644	19010172 ~ 19016833 (-)
XLOC_006555	lzts2a	coding	downstream	474797	18801094 ~ 18863680 (-)
XLOC_006554	CR932361.2	coding	downstream	623051	18715310 ~ 18715426 (-)
XLOC_006553	sfxn3	coding	downstream	643188	18677428 ~ 18695289 (-)
XLOC_006559	NA	coding	upstream	11415	19350851 ~ 19357011 (-)
XLOC_006560	rab11fip2	coding	upstream	271126	19610562 ~ 19642288 (-)
XLOC_006561	fam204a	coding	upstream	427460	19766896 ~ 19799824 (-)
XLOC_006562	AL954359.2	coding	upstream	878054	20217490 ~ 20222134 (-)
XLOC_006563	AL954359.1	coding	upstream	887609	20227045 ~ 20231750 (-)
XLOC_006471	BX537274.2	misc	downstream	9073572	10264741 ~ 10264905 (-)
XLOC_006338	rn7sk	misc	downstream	18512252	825904 ~ 826225 (-)
XLOC_006552	CR932438.2	non-coding	downstream	688795	18649492 ~ 18649682 (-)
XLOC_006551	CR932438.1	non-coding	downstream	693472	18644890 ~ 18645005 (-)
XLOC_006567	CU633804.1	non-coding	upstream	1207531	20546967 ~ 20547498 (-)
XLOC_006568	NA	non-coding	upstream	1390398	20729834 ~ 20731888 (-)

Expression

Co-expression Network