XLOC_006338 (rn7sk)



Basic Information


Item Value
gene id XLOC_006338
gene name rn7sk
gene type misc
species zebrafish (Danio rerio)
category of species model fish

Chromosome Information


Item Value
chromosome id NC_007124.7
NCBI id CM002897.2
chromosome length 52186027
location 825904 ~ 826225 (-)
genome version GRCz11_2017_zebrafish_Genome

Sequence


>TCONS_00012343
GGATGTGAGGGCGATCTGGCTGCGACATCTGTCACCCCATTGATCGCTAGGGTTGATTCGGCTGATCTGGCTGGCTAGGCGGGTGTCCCCTTCCTCCCTCACCGCTCCACGTGTGTCCCTCCCGAAGCTCCGCGCTCGGTGGAAGAGGACGAGTTTCCCCCGGCGGACACGAGCATCGCTGGTATAGAAGTAGCTGCGCTCCCCTGCTAGAACCTCCAAACAAGCTCAAGGCAACATTTGTAGGCGAAACGTAGGGAAGTCGAGCTCCAAGACTTCAGACACATCCAAATGAGGCACTGCATGTGGCAGTCTGCCTTTCTTT

Function


symbol description
rn7sk Orthologous to human RN7SK (RNA component of 7SK nuclear ribonucleoprotein).

GO: NA

KEGG: NA

ZFIN:

id description
ZDB-NCRNAG-190123-3 Orthologous to human RN7SK (RNA component of 7SK nuclear ribonucleoprotein).

Ensembl:

ensembl_id ENSDARG00000081270

RNA


RNA id representative length rna type GC content exon number start site end site
TCONS_00012343 True 322 misc_RNA 0.58 1 825904 826225

Neighbor


gene id symbol gene type direction distance location
XLOC_006337 polh coding downstream 1340 813579 ~ 824564 (-)
XLOC_006336 slit1a coding downstream 187419 555321 ~ 638485 (-)
XLOC_006335 nvl coding downstream 271871 516258 ~ 554033 (-)
XLOC_006334 NA coding downstream 330987 489738 ~ 494917 (-)
XLOC_006333 heatr5b coding downstream 346774 450002 ~ 479130 (-)
XLOC_006339 zgc:163080 coding upstream 26064 852289 ~ 856701 (-)
XLOC_006340 AL929536.6 coding upstream 35505 861730 ~ 865193 (-)
XLOC_006341 AL929536.5 coding upstream 40068 866293 ~ 869808 (-)
XLOC_006342 NA coding upstream 49720 875945 ~ 877808 (-)
XLOC_006343 BFSP1 coding upstream 159217 985442 ~ 992458 (-)
XLOC_006471 BX537274.2 misc upstream 9438516 10264741 ~ 10264905 (-)
XLOC_006332 NA non-coding downstream 380015 443374 ~ 445889 (-)
XLOC_006330 NA non-coding downstream 394308 430289 ~ 431596 (-)
XLOC_006329 NA non-coding downstream 404295 397310 ~ 421609 (-)
XLOC_006328 NA non-coding downstream 442684 377547 ~ 383220 (-)
XLOC_006345 NA non-coding upstream 270259 1096484 ~ 1098530 (-)
XLOC_006346 NA non-coding upstream 293964 1120189 ~ 1126101 (-)
XLOC_006350 NA non-coding upstream 434261 1260486 ~ 1269605 (-)
XLOC_006351 NA non-coding upstream 444703 1270928 ~ 1341882 (-)

Expression



Co-expression Network


Homologous


species gene id symbol gene type chromosome NCBI id location
rainbow trout (Oncorhynchus mykiss) G40413 NA non-coding NC_048565.1 CM023219.2 37892852 ~ 37893231 (-)
rainbow trout (Oncorhynchus mykiss) G116219 NA non-coding NC_048566.1 CM023220.2 15295142 ~ 15304868 (+)
rainbow trout (Oncorhynchus mykiss) G1687845 NA non-coding NC_048584.1 CM023238.2 34626718 ~ 34683245 (+)
eurasian perch (Perca fluviatilis) G195087 NA non-coding NC_053130.1 CM020927.1 19218736 ~ 19219042 (+)
eurasian perch (Perca fluviatilis) LOC120556527 LOC102787635,LOC101476187,LOC100691227,LOC106610718 misc NC_053114.1 CM020911.1 44791982 ~ 44915666 (-)
striped catfish (Pangasianodon hypophthalmus) G53729 NA non-coding NC_047597.1 CM018543.1 27530576 ~ 27803450 (-)
bowfin (Amia calva) G50736 cdk2,LOC107683630,LOC107570445,LOC107737371,LOC107696023 non-coding CM030126.1 CM030126.1 8357450 ~ 8360962 (-)
bowfin (Amia calva) G88762 NA non-coding CM030130.1 CM030130.1 31988774 ~ 31989050 (-)
tiger barb (Puntius tetrazona) G90232 NA non-coding NC_056711.1 CM032080.1 2481369 ~ 2481775 (+)
mexican tetra (Astyanax mexicanus) G33833 NA non-coding NC_035900.1 CM008303.1 2192090 ~ 2192968 (-)