G92334 (mcmbp,LOC107726945,LOC107601886,LOC107559330)


Basic Information

Item Value
gene id G92334
gene name mcmbp,LOC107726945,LOC107601886,LOC107559330
gene type non-coding
species tiger barb (Puntius tetrazona)
category of species ornamental fish

Chromosome Information

Item Value
chromosome id NC_056711.1
NCBI id CM032080.1
chromosome length 25085836
location 9479421 ~ 9479752 (+)
genome version ASM1883169v1_2021_tiger_barb_Genome

Sequence

>TU136670
ACTAACATCTTTCATCTGTTCGGTCTGTGTGTCCATCTCATCGTCCTCTTCATAGCTGCGTTTTTGCCTGTTTGGGACATAGGAAGTGGAGGGCACCACTCGCGCCTGGCTGGTACCTGCATAGCTTTCTTTGACCCACTGTGATTCTCCCGGGATGGGGACACAATAAAAAGTCTGTCTCTCTGAAGTAACTGCGTTTCTTGAGTTGAAGTCCACCT

Function

symbol description
mcmbp Predicted to enable chromatin binding activity. Predicted to be involved in DNA-dependent DNA replication and sister chromatid cohesion. Predicted to act upstream of or within DNA replication and cell division. Predicted to be located in nucleus. Is expressed in several structures, including alar plate midbrain region; blood; immature eye; nervous system; and ventral mesoderm. Orthologous to human MCMBP (minichromosome maintenance complex binding protein).

NR:

description
PREDICTED: mini-chromosome maintenance complex-binding protein-like isoform X2

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU136670 True 218 lncRNA 0.49 2 9479421 9479752

Neighbor

gene id symbol gene type direction distance location
inpp5f inpp5f,LOC107726944,LOC107666413,LOC107743504 coding upstream 5887 9457557 ~ 9473534 (+)
bag3 LOC107726946,LOC107666417,LOC107655437,LOC107743505,LOC107601798 coding upstream 22513 9451180 ~ 9456908 (+)
pkd2l1 pkd2l1,LOC107666396,LOC107726939,LOC107743506,LOC107559329,LOC107655425,LOC107601815 coding upstream 35713 9436681 ~ 9443708 (+)
si:dkey-51a16.9 si:dkey-51a16.9,LOC107559326,LOC107655434,LOC107743509,LOC107601881,LOC107666536,LOC108426796 coding upstream 51284 9422476 ~ 9428137 (+)
LOC122356913 LOC107559323,LOC107743586,LOC107666393,LOC107601813,LOC107726938 coding upstream 58946 9418159 ~ 9420475 (+)
LOC122356643 sec23ip,LOC107666414,LOC107655440,LOC107743502 coding downstream 2459 9482211 ~ 9491406 (+)
pcbd1 pcbd1,LOC107559335,LOC107743500,LOC107601888,LOC107655445 coding downstream 69981 9549733 ~ 9552495 (+)
neurog3 LOC107666354,LOC107726936,LOC107601803,LOC107655417 coding downstream 87865 9567617 ~ 9568527 (+)
bcl11aa bcl11aa,bcl11a,LOC107666449,LOC107601892,LOC107655449,LOC107559339,LOC107743494 coding downstream 135275 9615027 ~ 9667838 (+)
fancl fancl,LOC107585345,LOC107718841 coding downstream 571335 10051087 ~ 10067172 (+)
G92313 NA non-coding upstream 28732 9450446 ~ 9450689 (+)
G92147 NA non-coding upstream 203722 9264064 ~ 9275699 (+)
G92111 NA non-coding upstream 334910 9140217 ~ 9144511 (+)
G92108 erlin1,LOC107743516,LOC107725471,LOC107666491,LOC107601865,LOC107676597 non-coding upstream 381516 9050367 ~ 9097905 (+)
G92087 slc1a4,LOC107725464,LOC107552941 non-coding upstream 513832 8929442 ~ 8965589 (+)
LOC122356835 NA non-coding downstream 91237 9570989 ~ 9583671 (+)
G92361 NA non-coding downstream 112667 9592419 ~ 9594277 (+)
G92432 NA non-coding downstream 244644 9724396 ~ 9727967 (+)
G92434 NA non-coding downstream 250973 9730725 ~ 9731002 (+)
LOC122356803 NA non-coding downstream 565029 10044781 ~ 10049442 (+)
atoh7 atoh7,LOC107726941,LOC107601814,LOC107666420,LOC107743508,LOC107655428,LOC108426756 other upstream 44816 9430178 ~ 9434605 (+)
zgc:153981 zgc:153981,LOC107725455,LOC107666543,LOC107601871,LOC107671561,LOC107552921,LOC108426808 other upstream 315307 9161517 ~ 9164114 (+)
spef1 zgc:66426,LOC107601866,LOC107725472,LOC107666492,LOC107743614 other upstream 390300 9080848 ~ 9089121 (+)
fuom fuom,LOC107676595,LOC107666397,LOC107601808 other upstream 451512 9025943 ~ 9027909 (+)
sf3b5 sf3b5,LOC107601807 other upstream 739326 8739036 ~ 8740095 (+)
LOC122356813 adka,LOC107743514,LOC107666490,LOC107601874,LOC107655429,LOC107725426,LOC100196663 other downstream 725361 10205113 ~ 10249725 (+)
ly6pge si:ch73-28h20.1,LOC107716297,LOC107673896,LOC107585320,LOC105890420,LOC106578825 other downstream 936488 10416240 ~ 10420426 (+)
eif4ebp2 eif4ebp2,LOC107668794,LOC107588631,LOC107716353,LOC107564345,LOC107707337,LOC107673927 other downstream 1485103 10964855 ~ 10968914 (+)
G92772 LOC107588620,LOC107707271,LOC107707282 other downstream 1733774 11213526 ~ 11218175 (+)
cxcl12a cxcl12a,LOC107588617,LOC107707253,LOC107548639,LOC107673912,LOC107757152 other downstream 1775842 11255594 ~ 11262620 (+)

Expression


Co-expression Network