G125750


Basic Information

Item Value
gene id G125750
gene name NA
gene type non-coding
species tiger barb (Puntius tetrazona)
category of species ornamental fish

Chromosome Information

Item Value
chromosome id NC_056716.1
NCBI id CM032085.1
chromosome length 26409628
location 12393511 ~ 12394732 (+)
genome version ASM1883169v1_2021_tiger_barb_Genome

Sequence

>TU185692
gatatatatatatattgtgacgagtcggctgcccctcctctttattgtcaccatcaccccgtcctttattcgccgcccttcaccaggctcccgacgggagtgggtgtgttcgagaggaggggcgtggtatcggtcaggtctggcggcgtgtgacgaggcacacctgaaggggattagccttgtcaccgtcgccgttaaatacctgaccgcgtctctcctcgggagaccgaccggtctcttccccgtgcatgcacgctggtgtcctcgtgggtccagg

Function

GO:

id name namespace
GO:0090090 negative regulation of canonical Wnt signaling pathway biological_process
GO:0060828 regulation of canonical Wnt signaling pathway biological_process

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU185692 True 277 lncRNA 0.60 2 12393511 12394732

Neighbor

gene id symbol gene type direction distance location
nectin1b nectin1,pvrl1b,LOC107670612,LOC107691861,LOC107563312,LOC107758086,LOC107561861 coding upstream 14259 12189464 ~ 12379252 (+)
LOC122323085 LOC107691900,LOC107574923,LOC107715548 coding upstream 491555 11898259 ~ 11901956 (+)
pgr LOC107563516,LOC107691935,LOC107732778,LOC107709819,LOC107684613 coding upstream 1032706 11351812 ~ 11360805 (+)
baz1b baz1b,LOC107684612,LOC107709818,LOC107714438 coding upstream 1131441 11245321 ~ 11262070 (+)
bcl7bb bcl7bb,LOC107557834,LOC107692047,LOC107711066,LOC107709815,LOC108429883 coding upstream 1148819 11240627 ~ 11244692 (+)
LOC122362670 LOC107691836,LOC107758058,LOC107578181,LOC107572720,LOC107670622,LOC107714531 coding downstream 197335 12592067 ~ 12595389 (+)
st14a LOC107758079,LOC107668533,LOC107554966,LOC107714535,LOC107670627 coding downstream 459428 12854160 ~ 12867723 (+)
dhx34 dhx34 coding downstream 473309 12868041 ~ 12875690 (+)
bicra gltscr1,LOC107758076,LOC107565091,LOC107554986,LOC107670631,LOC107668814,LOC107714538 coding downstream 497252 12891984 ~ 12904583 (+)
ehd2b ehd2,ehd2b,LOC107565090,LOC107668886,LOC107670629,LOC107554987 coding downstream 510610 12905342 ~ 12914313 (+)
G125714 LOC107568232,LOC107671620 non-coding upstream 354067 12038945 ~ 12039444 (+)
G125709 NA non-coding upstream 489519 11903459 ~ 11903992 (+)
LOC122362586 NA non-coding upstream 1084001 11307547 ~ 11309510 (+)
G125540 NA non-coding upstream 1094251 11299003 ~ 11299260 (+)
G125480 rasa2,LOC107566682,LOC107714449,LOC107679023,LOC107679004,LOC107710946,LOC107684605 non-coding upstream 1349445 10936365 ~ 11044066 (+)
G125753 NA non-coding downstream 17133 12411865 ~ 12412245 (+)
G125760 NA non-coding downstream 184993 12579725 ~ 12589944 (+)
G125783 NA non-coding downstream 241424 12636156 ~ 12636383 (+)
G125784 NA non-coding downstream 246460 12641192 ~ 12641436 (+)
G125855 si:ch211-71n6.4,LOC107758068,LOC107753016,LOC107670624,LOC107578946,LOC105902995 non-coding downstream 615142 13009874 ~ 13012900 (+)
trpc6b trpc6b,trpc6a,LOC107713306,LOC107691992,LOC108429885,LOC108264040 other upstream 1047714 11330221 ~ 11345797 (+)
selenot1b selt1b,LOC107710848,LOC107684611,LOC107557827,LOC108429894 other upstream 1156364 11234331 ~ 11237147 (+)
ccnl1a ccnl1a,LOC107710830,LOC107563513,LOC107684610,LOC107691967,LOC107557837 other upstream 1159697 11226113 ~ 11233814 (+)
G125496 snrpd2,LOC106612977 other upstream 1423744 10968085 ~ 10969767 (+)
G125461 ugt5c1,LOC107692742,LOC107738533 other upstream 1556235 10824974 ~ 10837276 (+)
G125830 NA other downstream 414718 12809450 ~ 12822781 (+)
G125836 NA other downstream 485856 12880588 ~ 12884612 (+)
napab napab,LOC107668964,LOC107758075,LOC107670630,LOC107714540,LOC107565089,LOC108413256 other downstream 522494 12917226 ~ 12925468 (+)
glb1l2 glb1l2,si:dkey-224e22.2,LOC107554970 other downstream 552109 12946841 ~ 12955945 (+)
LOC122362547 LOC107672480,LOC107758042,LOC107554971 other downstream 821752 13216484 ~ 13222148 (+)

Expression


Co-expression Network