G19489



Basic Information


Item Value
gene id G19489
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information


Item Value
chromosome id CI01000001
NCBI id null
chromosome length 13537560
location 11887468 ~ 11887883 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence


>TU21903
GGGAAATGAAGGTGATTTAAGTGACTTTGAACATAGCATGGCTGTTGGTGCATGATGGGCTATTCTGAGTGCTTCAGAAAATATCCACTGAGCGGCAGTTCTGTGGGTGAAAATGCCTTGTTGATGCCAGAGATCAGAGGAGGATGGCCAGACTGGATTGAGCTTATAGAAAGGCAACAGTAACTCAAATAACCACTCTTTACAACCGAGGTCTGCGGAAGAACTCACAACACGTCGGACTTTTTAAGCAAATGGACTACAGCAGCAGATGATCACACAGGACAATAGAAGATTGGAAAAATGTTGCCTGGTCTGATGAGTCTCGATTTCTGCTGTGACATTTAGATGGTAGGGTCAGAATTTGGTGTAATCAACATGAAAGCATGGATCCCTCCTGCCTTGTATCAATGGTTCAG

Function


NR:

description
PREDICTED: PTB-containing, cubilin and LRP1-interacting protein isoform X2

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU21903 True 416 lncRNA 0.45 1 11887468 11887883

Neighbor


gene id symbol gene type direction distance location
CI01000001_11809724_11812692 LZIC coding upstream 74024 11809427 ~ 11813444 (+)
CI01000001_11756218_11760009 NA coding upstream 125971 11756161 ~ 11761497 (+)
CI01000001_11656975_11660666 TARDBPL, TARDBP coding upstream 225602 11656029 ~ 11661866 (+)
CI01000001_11440491_11445508 NA coding upstream 441928 11439979 ~ 11445540 (+)
CI01000001_11431153_11431434 NA coding upstream 455881 11429876 ~ 11431587 (+)
CI01000001_11898621_11898914 NA coding downstream 10414 11898297 ~ 11900188 (+)
CI01000001_11990189_11991073 AURKAIP1 coding downstream 100194 11988077 ~ 11991195 (+)
CI01000001_11994138_12003906 NA coding downstream 106255 11994138 ~ 12004100 (+)
CI01000001_12006266_12048809 DVL1A, DVL1B, DVL1 coding downstream 118045 12005928 ~ 12049045 (+)
CI01000001_12058281_12060612 NA coding downstream 169872 12057755 ~ 12061261 (+)
G19488 NA non-coding upstream 267 11886948 ~ 11887201 (+)
G19438 NA non-coding upstream 11216 11852354 ~ 11876252 (+)
G19435 NA non-coding upstream 56345 11830532 ~ 11831123 (+)
G19353 NA non-coding upstream 72754 11814514 ~ 11814714 (+)
G19358 NA non-coding upstream 90158 11794804 ~ 11797310 (+)
G19490 NA non-coding downstream 221 11888104 ~ 11888510 (+)
G19469 NA non-coding downstream 19734 11907617 ~ 11967369 (+)
G19512 NA non-coding downstream 104149 11992032 ~ 11992375 (+)
G19473 NA non-coding downstream 167045 12054928 ~ 12055598 (+)
G19538 NA non-coding downstream 221680 12109563 ~ 12481405 (+)
G19395 NA other upstream 205651 11681322 ~ 11681817 (+)
G19314 NA other upstream 328795 11501194 ~ 11558673 (+)
G19039 NA other upstream 1033485 10850924 ~ 10853983 (+)
CI01000001_10538498_10539667 RPS26 other upstream 1347622 10538388 ~ 10539846 (+)
G18937 NA other upstream 1411079 10474984 ~ 10476389 (+)
CI01000001_13514115_13517063 NA other downstream 1625521 13514115 ~ 13517063 (+)

Expression



Co-expression Network


Homologous


species gene id symbol gene type chromosome NCBI id location
striped catfish (Pangasianodon hypophthalmus) G381366 NA non-coding NC_047621.1 CM018567.1 5115429 ~ 5116989 (-)