G28136


Basic Information

Item Value
gene id G28136
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000004
NCBI id null
chromosome length 17451736
location 5717112 ~ 5722122 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU31793
AACTGAGTGTTTATAAAACTCATTTGTTATGGCACAAAAGCCTAGAAAATGTATGATCAGGTGTTGATGGATAAGAATTGTTGATGTTCATCATTTAGTGTCCTGATTCACTGTTCTCATTCAGAGTCTAGTCTCTGATTAAATGGATGATGTATACTTCGTTTTCTTGATTATAGTGAAACTGTGATTCTACAGTTTACGGGACAGCAGTGTTGTGGCAATCAGACTTTACAGACAGTTTTCATCTATGGCATCACTCAGACTCATACAAACATCAAGAATCAGCATATGAATCTCAACAATGGCG

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU31793 True 307 lncRNA 0.36 2 5717112 5722122

Neighbor

gene id symbol gene type direction distance location
CI01000004_05474127_05476501 NA coding upstream 240357 5473079 ~ 5476755 (+)
CI01000004_05459139_05467673 PTBP2B, PTBP2 coding upstream 248255 5459139 ~ 5468857 (+)
CI01000004_05454350_05455993 NA coding upstream 261119 5453841 ~ 5455993 (+)
CI01000004_05397192_05402109 HCCSA.1, RWDD3 coding upstream 315003 5397095 ~ 5402109 (+)
CI01000004_05389431_05393230 TMEM56 coding upstream 322901 5389370 ~ 5394211 (+)
CI01000004_05735852_05752650 PLPPR4, PLPPR4A coding downstream 13676 5735798 ~ 5754011 (+)
CI01000004_05781905_05788633 PALMD coding downstream 59480 5781602 ~ 5790006 (+)
CI01000004_05800602_05802011 NA coding downstream 78480 5800602 ~ 5802087 (+)
CI01000004_05812640_05834517 AGL, AGLA coding downstream 90518 5812640 ~ 5834517 (+)
CI01000004_05837208_05841141 NA coding downstream 115086 5837208 ~ 5841141 (+)
G28023 NA non-coding upstream 71697 5645177 ~ 5645415 (+)
G28020 NA non-coding upstream 74999 5641840 ~ 5642113 (+)
G28018 NA non-coding upstream 77180 5639731 ~ 5639932 (+)
G27924 NA non-coding upstream 135402 5481805 ~ 5581710 (+)
G27944 NA non-coding upstream 237363 5479535 ~ 5479749 (+)
G28178 NA non-coding downstream 124354 5846476 ~ 5846828 (+)
G28148 NA non-coding downstream 159359 5881481 ~ 6018658 (+)
G28159 NA non-coding downstream 223576 5945698 ~ 5947048 (+)
G28154 NA non-coding downstream 229547 5951669 ~ 5953194 (+)
G28213 NA non-coding downstream 300340 6022462 ~ 6022687 (+)
G27805 NA other upstream 343309 5372825 ~ 5373803 (+)
CI01000004_03550525_03552621 PTGER4C other upstream 2164666 3550329 ~ 3553423 (+)
G26245 NA other upstream 2194719 3509017 ~ 3522393 (+)
CI01000004_02745885_02768971 NA other upstream 2958174 2745885 ~ 2769135 (+)
G25992 NA other upstream 2980344 2736536 ~ 2736768 (+)
G28165 NA other downstream 10467 5732589 ~ 5733001 (+)
G28302 NA other downstream 747906 6470028 ~ 6502087 (+)
CI01000004_06571261_06572539 SEP15 other downstream 849098 6570771 ~ 6572667 (+)
CI01000004_07654234_07655677 MRPL34 other downstream 1932650 7654234 ~ 7656383 (+)
CI01000004_08414451_08436256 NA other downstream 2711583 8414316 ~ 8439933 (+)

Expression


Co-expression Network