G28154


Basic Information

Item Value
gene id G28154
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000004
NCBI id null
chromosome length 17451736
location 5951669 ~ 5953194 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU31818
GGTTGATCTTCTGCTTGGCACCCATGAAAGCTTTCTTGGTCTTCTCTTCTTTATCAGCGATCTGCTGTCGGAGCTGCTCCTCCAGGTTACCCTTCTCCTGTAGCTCTGCTCTCAGACGGTTGAGCTCTGGCTGCACCTGTGCCAACTGCTCCTGCAGGCTCTTCACCTCCACTTCACGCTCCTGCACCACCTTCTGTATGCTTTCCAGCTGAGTTTCCAGCTCTGAGGATCTGTTCTGCGCCTGACTCAATGAACTCTTCAGGTTCTGAATCTCCTGCACCGAGGCCTGACGGTCTTCCTGCTCCTGTGCTGGCTTAGAAGCAGCCTCTGC

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU31818 True 331 lncRNA 0.55 2 5951669 5953194

Neighbor

gene id symbol gene type direction distance location
CI01000004_05936410_05942402 NA coding upstream 9164 5935178 ~ 5942505 (+)
CI01000004_05920907_05931169 RXRGA, RXRGB, RXRAA coding upstream 20201 5920907 ~ 5931468 (+)
CI01000004_05870493_05877153 OLFML2BB coding upstream 74227 5870493 ~ 5877442 (+)
CI01000004_05837208_05841141 NA coding upstream 110528 5837208 ~ 5841141 (+)
CI01000004_05812640_05834517 AGL, AGLA coding upstream 117152 5812640 ~ 5834517 (+)
CI01000004_05968468_05973840 NA coding downstream 15274 5968468 ~ 5973840 (+)
CI01000004_05995720_05996936 NA coding downstream 42526 5995720 ~ 5998165 (+)
CI01000004_06023884_06040211 PLA2G4A, PLA2G4AA coding downstream 70690 6023884 ~ 6040434 (+)
CI01000004_06044460_06046940 ARPC5, ARPC5B, ARPC5A coding downstream 90933 6044127 ~ 6048111 (+)
CI01000004_06054498_06061215 IVNS1ABP, IVNS1ABPB coding downstream 99618 6052812 ~ 6061383 (+)
G28159 NA non-coding upstream 4621 5945698 ~ 5947048 (+)
G28178 NA non-coding upstream 104841 5846476 ~ 5846828 (+)
G28136 NA non-coding upstream 229547 5717112 ~ 5722122 (+)
G28023 NA non-coding upstream 306254 5645177 ~ 5645415 (+)
G28020 NA non-coding upstream 309556 5641840 ~ 5642113 (+)
G28213 NA non-coding downstream 69268 6022462 ~ 6022687 (+)
G28218 NA non-coding downstream 89950 6043144 ~ 6043395 (+)
G28219 NA non-coding downstream 90449 6043643 ~ 6043963 (+)
G28220 NA non-coding downstream 114952 6068146 ~ 6068741 (+)
G28241 NA non-coding downstream 217226 6170420 ~ 6170655 (+)
G28165 NA other upstream 218668 5732589 ~ 5733001 (+)
G27805 NA other upstream 577866 5372825 ~ 5373803 (+)
CI01000004_03550525_03552621 PTGER4C other upstream 2399223 3550329 ~ 3553423 (+)
G26245 NA other upstream 2429276 3509017 ~ 3522393 (+)
CI01000004_02745885_02768971 NA other upstream 3192731 2745885 ~ 2769135 (+)
G28302 NA other downstream 516834 6470028 ~ 6502087 (+)
CI01000004_06571261_06572539 SEP15 other downstream 618026 6570771 ~ 6572667 (+)
CI01000004_07654234_07655677 MRPL34 other downstream 1701578 7654234 ~ 7656383 (+)
CI01000004_08414451_08436256 NA other downstream 2480511 8414316 ~ 8439933 (+)
G28859 NA other downstream 2646041 8599235 ~ 8599603 (+)

Expression


Co-expression Network