G28855


Basic Information

Item Value
gene id G28855
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000004
NCBI id null
chromosome length 17451736
location 8554232 ~ 8554563 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU32631
GTACAAACCCGATTCCAAAAAAGTTGGGACACTGTACAAATTGTGAATAAAAAAGGAATGCAATAATTTACAAATCTCATAAACTTATATTTTATTCACAATAGAATATAGATAGCATATCAAATGTTGAAAGTGAGACATTTTGAAATGTCATGCCAAATATTGGCTCATTTTGGATTTCATGAGAGCTACACATTCCAAAAAAGTTGGGACAGGTAGCAATAAGAGGCCGGAAAAGATAAATGTACATAAGGAACAGCTGGAGGACCAATTTGCAACTTATTAGGTCAATTGGCAACATGATTGGGTATAAAAAGAGCCTCTCAGAGTGG

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU32631 True 332 lncRNA 0.34 1 8554232 8554563

Neighbor

gene id symbol gene type direction distance location
CI01000004_08518587_08521540 EIF5A2, EIF5A.L, EIF5A coding upstream 32571 8518462 ~ 8521661 (+)
CI01000004_08507941_08515797 SLC2A2 coding upstream 37924 8507941 ~ 8516308 (+)
CI01000004_08458998_08503889 TNIK, TNIKA coding upstream 50240 8458998 ~ 8503992 (+)
CI01000004_08414451_08436256 NA coding upstream 117969 8414316 ~ 8439933 (+)
CI01000004_08382042_08402126 PLD1A coding upstream 151718 8380472 ~ 8402514 (+)
CI01000004_08573940_08586930 NA coding downstream 18178 8572741 ~ 8587170 (+)
CI01000004_08618566_08669147 NA coding downstream 64003 8618566 ~ 8669147 (+)
CI01000004_08693419_08703448 PLPPR3A coding downstream 138856 8693419 ~ 8704156 (+)
CI01000004_08730011_08731219 PALM1B coding downstream 175448 8730011 ~ 8732509 (+)
CI01000004_08736175_08742487 PTBP1B, PTBP1, PTBP1A coding downstream 181612 8736175 ~ 8744387 (+)
G28849 NA non-coding upstream 26557 8527445 ~ 8527675 (+)
G28848 NA non-coding upstream 82348 8470745 ~ 8471884 (+)
G28843 NA non-coding upstream 143012 8410726 ~ 8411220 (+)
G28835 NA non-coding upstream 185159 8368861 ~ 8369073 (+)
G28834 NA non-coding upstream 188311 8365695 ~ 8365921 (+)
G28858 NA non-coding downstream 41289 8595852 ~ 8597783 (+)
G28861 NA non-coding downstream 48060 8602623 ~ 8602843 (+)
G28862 NA non-coding downstream 48532 8603095 ~ 8603461 (+)
G28863 NA non-coding downstream 49042 8603605 ~ 8603927 (+)
G28867 NA non-coding downstream 51751 8606314 ~ 8606585 (+)
CI01000004_07654234_07655677 MRPL34 other upstream 897849 7654234 ~ 7656383 (+)
CI01000004_06571261_06572539 SEP15 other upstream 1979811 6570771 ~ 6572667 (+)
G28302 NA other upstream 2052145 6470028 ~ 6502087 (+)
G28165 NA other upstream 2821231 5732589 ~ 5733001 (+)
G28859 NA other downstream 44672 8599235 ~ 8599603 (+)
CI01000004_08976512_08980033 TTPA other downstream 421875 8976254 ~ 8980984 (+)
G30797 NA other downstream 1942813 10497376 ~ 10497788 (+)
G31710 NA other downstream 3082688 11637251 ~ 11642400 (+)
CI01000004_11666900_11667179 NA other downstream 3110210 11666900 ~ 11667659 (+)

Expression


Co-expression Network