CI01000006_09320331_09321778 (UB2G1, UBE2G1A, UBE2G1, UBE2G1B)


Basic Information

Item Value
gene id CI01000006_09320331_09321778
gene name UB2G1, UBE2G1A, UBE2G1, UBE2G1B
gene type coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000006
NCBI id null
chromosome length 13024002
location 9320331 ~ 9321778 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>CI01000006_09320331_09321778.mRNA
ATGACTGAGCAATCGGCCCTGCTTCTGCGAAAACAGCTAGCAGAGCTCAACAAAAACCCAGTGGAAGGTTTTTCTGCTGGTCTGATTGATGATGAGGATATCTATCAGTGGGAGGTTGTCGTGATTGGCCCTCAAGACACATTGTTCGAAGGTGGATTTTTTAAGGCGCATCTCATCTTCCCTCATGATTACCCACTTCGGCCTCCTAAGATGAAGTTTATTACTGAGATTTGGCATCCTAATGTTGCGAAGAACGGAGATGTGTGCATTTCAATCCTACATGAGCCAGGAGAGGACAAATTTGGCTATGAGAAACCCGAGGAGCGTTGGCTGCCCATCCACACTGTAGAGACCATCATGATTAGTGTGATCTCCATGTTAGCTGACCCCAATGGGGACTCGCCAGCCAATGTGGATGCAGCT

Function

symbol description
ube2g1b Predicted to enable ubiquitin conjugating enzyme activity. Predicted to be involved in proteasome-mediated ubiquitin-dependent protein catabolic process and protein polyubiquitination. Orthologous to human UBE2G1 (ubiquitin conjugating enzyme E2 G1).
ube2g1a Predicted to enable ubiquitin conjugating enzyme activity. Predicted to be involved in proteasome-mediated ubiquitin-dependent protein catabolic process and protein polyubiquitination. Orthologous to human UBE2G1 (ubiquitin conjugating enzyme E2 G1).
ube2g1 Enables ubiquitin conjugating enzyme activity and ubiquitin protein ligase binding activity. Involved in protein K48-linked ubiquitination and protein K63-linked ubiquitination. Acts upstream of or within cellular protein catabolic process. Located in extracellular exosome.

GO:

id name namespace
GO:0005737 cytoplasm cellular_component

KEGG:

id description
K10575 UBE2G1, UBC7; ubiquitin-conjugating enzyme E2 G1

RNA

RNA id representative length rna type GC content exon number start site end site
CI01000006_09320331_09321778.mRNA True 423 mRNA 0.48 4 9320331 9321778

Neighbor

gene id symbol gene type direction distance location
CI01000006_09192219_09195918 NA coding upstream 124347 9191897 ~ 9195984 (+)
CI01000006_09107491_09114820 GTF3C4 coding upstream 205260 9106826 ~ 9115071 (+)
CI01000006_09105004_09106470 NA coding upstream 213368 9104215 ~ 9106963 (+)
CI01000006_09098943_09103197 NA coding upstream 216159 9098682 ~ 9104172 (+)
CI01000006_09066050_09070383 BARH1, BARHL1B, BARHL1 coding upstream 249750 9065962 ~ 9070581 (+)
CI01000006_09334843_09337295 FAM216A coding downstream 13023 9334801 ~ 9337403 (+)
CI01000006_09497508_09511925 NA coding downstream 175028 9496806 ~ 9512720 (+)
CI01000006_09569228_09574340 NA coding downstream 246502 9568280 ~ 9575061 (+)
CI01000006_09712289_09783579 UNC5DA coding downstream 390511 9712289 ~ 9783579 (+)
CI01000006_09836923_09844045 NA coding downstream 515145 9836923 ~ 9846207 (+)
G46278 NA non-coding upstream 36436 9190362 ~ 9283895 (+)
G46325 NA non-coding upstream 94914 9218451 ~ 9225417 (+)
G46316 NA non-coding upstream 122944 9189983 ~ 9197387 (+)
G46296 NA non-coding upstream 161425 9158577 ~ 9158906 (+)
G46288 NA non-coding upstream 172439 9147671 ~ 9147892 (+)
G46360 NA non-coding downstream 29420 9351198 ~ 9351415 (+)
G46371 NA non-coding downstream 56281 9378059 ~ 9378334 (+)
G46383 NA non-coding downstream 94242 9416020 ~ 9416289 (+)
G46470 NA non-coding downstream 124667 9446445 ~ 9446677 (+)
G46483 NA non-coding downstream 148604 9470382 ~ 9484816 (+)
G45416 NA other upstream 485634 8818814 ~ 8834697 (+)
G45355 NA other upstream 1107943 8209555 ~ 8212388 (+)
CI01000006_08198328_08199463 NA other upstream 1120186 8197881 ~ 8200145 (+)
G45336 NA other upstream 1298380 8019342 ~ 8021951 (+)
G45265 NA other upstream 1399976 7883867 ~ 7920355 (+)
G46652 NA other downstream 834801 10156579 ~ 10159251 (+)
G47145 NA other downstream 1163580 10485358 ~ 10511806 (+)
G47159 NA other downstream 2094451 11416229 ~ 11521703 (+)
G47318 NA other downstream 2302489 11624267 ~ 11638252 (+)
G48094 NA other downstream 2955842 12277620 ~ 12279541 (+)

Expression


Co-expression Network

Homologous

species gene id symbol gene type chromosome NCBI id location
zebrafish (Danio rerio) XLOC_019480 ube2g1b coding NC_007132.7 CM002905.2 17031635 ~ 17037907 (-)