G47681


Basic Information

Item Value
gene id G47681
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000006
NCBI id null
chromosome length 13024002
location 11111614 ~ 11115511 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU54231
CTCCTCTCCTTTCTCTCCAGGTGAGCCTGATTCACCCTTATAGCCTAGAGGACCCTTCGGTCCTGGAATCCCTGGAGACCCATGAGGCCCGTCCAGTCCGTTTTCCCCATCCTTTCCATAGACTCCTGCTCTTCCAACCACACCTTTTGGTCCACGGTCACCCATGTCTCCCATACGTCCTGGACGTCCTCGTTCACCTGGCTCCCCAGGTGGCCCCTGTGGCCCAGGTTTCCCCATCTCTCCTTCCGGACCAGGCAGACCTTGCGCTCTAGGCCAGCCTGCACGGAGAAGCTGGAAGAACGATGTTTGCTGAAACGCAGCCCATTC

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU54231 True 327 lncRNA 0.34 6 11111614 11115511

Neighbor

gene id symbol gene type direction distance location
CI01000006_10676705_10699710 NA coding downstream 411732 10676367 ~ 10699882 (-)
CI01000006_10499329_10508831 NA coding downstream 601959 10499240 ~ 10509655 (-)
CI01000006_10453630_10483241 NA coding downstream 627608 10453613 ~ 10484006 (-)
CI01000006_10402704_10447782 NA coding downstream 662513 10402695 ~ 10449101 (-)
CI01000006_10372387_10387314 NA coding downstream 724012 10372129 ~ 10387602 (-)
CI01000006_11320839_11338355 STXBP1, STXBP1A coding upstream 204951 11320462 ~ 11338355 (-)
CI01000006_11388077_11391485 NA coding upstream 271983 11387494 ~ 11391485 (-)
CI01000006_11459706_11462546 NA coding upstream 343777 11459288 ~ 11462605 (-)
CI01000006_11530728_11535297 NA coding upstream 414855 11530366 ~ 11535900 (-)
CI01000006_11596063_11609407 NA coding upstream 480128 11595639 ~ 11609407 (-)
G47673 NA non-coding downstream 42566 11063673 ~ 11069048 (-)
G47668 NA non-coding downstream 56033 11054903 ~ 11055581 (-)
G47654 NA non-coding downstream 92405 11017763 ~ 11019209 (-)
G47638 NA non-coding downstream 122811 10974694 ~ 10988803 (-)
G47622 NA non-coding downstream 186004 10917556 ~ 10925610 (-)
G47758 NA non-coding upstream 172124 11287635 ~ 11292481 (-)
G47806 NA non-coding upstream 363595 11479106 ~ 11482501 (-)
G47812 NA non-coding upstream 388067 11503578 ~ 11504962 (-)
G47853 NA non-coding upstream 524918 11640429 ~ 11641264 (-)
G47854 NA non-coding upstream 530016 11645527 ~ 11648165 (-)
G47658 NA other downstream 78487 11030911 ~ 11033127 (-)
CI01000006_07500281_07507754 NA other downstream 3600658 7500246 ~ 7507976 (-)
CI01000006_06974359_06976736 NA other downstream 4134742 6973224 ~ 6976872 (-)
CI01000006_04560607_04560993 NA other downstream 6549546 4559509 ~ 4562068 (-)
CI01000006_11651067_11653761 SMD3, SNRPD3, SNRPD3L, MGC52856 other upstream 534852 11650363 ~ 11654424 (-)
CI01000006_12348300_12348961 GLRX other upstream 1218898 12347180 ~ 12349383 (-)
CI01000006_12569291_12581457 CELL, CEL.2, CEL.1 other upstream 1235248 12569205 ~ 12582487 (-)

Expression


Co-expression Network