G48578


Basic Information

Item Value
gene id G48578
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000006
NCBI id null
chromosome length 13024002
location 12701590 ~ 12701857 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU55246
CTTGAAAGTGGTAATAACGTTGCTGCCTATGTGTGGTTCAGATATCTCTCAGATTTCATCAAAAATATCTTAATTTGTGTTCCGAAGACGAATGAAGGTCTTACCCACGTAGAAGGCGATGTTCTCAGGACCTTGCGCAACATTCCCAAAAAGTTCTCTAAAGGTGACAAAAATTCCAAACCTTTACAGAACATTCGGAACGTTCCTAAAACGTCCTATTTTGGTAATGAAAGTGCTGCAGTTCAAGGTTCCTTATATGACTTTAGGG

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU55246 True 268 lncRNA 0.32 1 12701590 12701857

Neighbor

gene id symbol gene type direction distance location
CI01000006_12677322_12678268 NA coding downstream 23322 12677162 ~ 12678268 (-)
CI01000006_12670692_12674459 NA coding downstream 27131 12670692 ~ 12674459 (-)
CI01000006_12647432_12651091 NA coding downstream 50499 12647003 ~ 12651091 (-)
CI01000006_12583905_12591335 GTF3C5 coding downstream 110255 12583784 ~ 12591335 (-)
CI01000006_12569291_12581457 CELL, CEL.2, CEL.1 coding downstream 119103 12569205 ~ 12582487 (-)
CI01000006_12718517_12732483 PRLR, PRLRA coding upstream 16529 12718386 ~ 12733092 (-)
CI01000006_12853718_12865868 NA coding upstream 151824 12853681 ~ 12865868 (-)
CI01000006_12876023_12888072 NA coding upstream 173971 12875828 ~ 12888072 (-)
CI01000006_12891987_12901219 ZNF532 coding upstream 189689 12891546 ~ 12901219 (-)
CI01000006_12921799_12924125 RX3, RAX coding upstream 219758 12921615 ~ 12924156 (-)
G48577 NA non-coding downstream 1322 12700069 ~ 12700268 (-)
G48576 NA non-coding downstream 1808 12699472 ~ 12699782 (-)
G48571 NA non-coding downstream 47700 12653629 ~ 12653890 (-)
G48459 NA non-coding downstream 238079 12462404 ~ 12463511 (-)
G48422 NA non-coding downstream 523396 12171561 ~ 12178194 (-)
G48579 NA non-coding upstream 7413 12709270 ~ 12709479 (-)
G48580 NA non-coding upstream 11298 12713155 ~ 12713603 (-)
G48627 NA non-coding upstream 93680 12795537 ~ 12795763 (-)
G48628 NA non-coding upstream 93978 12795835 ~ 12796174 (-)
G48629 NA non-coding upstream 94484 12796341 ~ 12796644 (-)
CI01000006_12348300_12348961 GLRX other downstream 352519 12347180 ~ 12349383 (-)
CI01000006_11651067_11653761 SMD3, SNRPD3, SNRPD3L, MGC52856 other downstream 1047183 11650363 ~ 11654424 (-)
G47658 NA other downstream 1668463 11030911 ~ 11033127 (-)
CI01000006_10453630_10483241 NA other downstream 2213155 10453613 ~ 10484006 (-)

Expression


Co-expression Network