G52513


Basic Information

Item Value
gene id G52513
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000009
NCBI id null
chromosome length 16003125
location 3278744 ~ 3279333 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU59831
CTCTTTTCTAAGGCCACTCTGATGTTGGTCTCGATGCTGGTCCTCTTCTTGCGGCGGCGGTTCAGGCCCTCCAAGCCCAGCCCAGGCGAGCCAAGAGAGCTGGGACTGGACAGGGCCTGGTCAGACGTCTGGTTCTCTGCACAAACTGCATCATTGAGCCATTTTTCAAGCAGAGGCTTCAGTTTGCACATGTTTTTAAAGCTCAGGTTCAAGGCCTCAAAGCGAGAAATGGTGGTTTGGCTGAAGTCATTTCCATAAAGTTTTCCCATGGCAAGGCCAAC

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU59831 True 281 lncRNA 0.52 2 3278744 3279333

Neighbor

gene id symbol gene type direction distance location
CI01000009_03264437_03267242 NA coding downstream 11502 3264437 ~ 3267242 (-)
CI01000009_03261739_03262843 NA coding downstream 15901 3261038 ~ 3262843 (-)
CI01000009_03244366_03259106 ILDR2 coding downstream 19638 3243598 ~ 3259106 (-)
CI01000009_03235111_03242103 NA coding downstream 36641 3235014 ~ 3242103 (-)
CI01000009_03226613_03234223 ME3.L, ME3 coding downstream 44521 3225768 ~ 3234223 (-)
CI01000009_03292206_03295043 NA coding upstream 12873 3292206 ~ 3295043 (-)
CI01000009_03306370_03311820 NA coding upstream 26956 3306289 ~ 3311820 (-)
CI01000009_03358707_03369503 PPP2R3B coding upstream 78675 3358008 ~ 3369577 (-)
CI01000009_03378591_03380390 NA coding upstream 99226 3378559 ~ 3381365 (-)
CI01000009_03568782_03574843 NA coding upstream 289322 3568655 ~ 3574843 (-)
G52592 NA non-coding downstream 54945 3223490 ~ 3223799 (-)
G52593 NA non-coding downstream 55783 3222632 ~ 3222961 (-)
G52521 NA non-coding downstream 56802 3220732 ~ 3221942 (-)
G52496 NA non-coding downstream 71318 3202765 ~ 3207426 (-)
G52494 NA non-coding downstream 122598 3150263 ~ 3156146 (-)
G52501 NA non-coding upstream 7985 3287318 ~ 3290823 (-)
G52606 NA non-coding upstream 21616 3300949 ~ 3302661 (-)
G52623 NA non-coding upstream 102651 3381984 ~ 3386060 (-)
G52639 NA non-coding upstream 127330 3406663 ~ 3406876 (-)
G52670 NA non-coding upstream 175010 3454343 ~ 3454550 (-)
CI01000009_02885473_02893975 NA other downstream 379337 2883688 ~ 2893975 (-)
G52410 NA other downstream 716211 2551724 ~ 2562533 (-)
G52098 NA other downstream 1871117 1401932 ~ 1407627 (-)
G52828 NA other upstream 938087 4217420 ~ 4231469 (-)
G53515 NA other upstream 2223062 5502395 ~ 5505248 (-)
G55814 NA other upstream 5146488 8425821 ~ 8428012 (-)
CI01000009_08858198_08860555 NA other upstream 5578819 8856310 ~ 8860563 (-)
G59097 NA other upstream 9008884 12288217 ~ 12289518 (-)

Expression


Co-expression Network

Homologous

species gene id symbol gene type chromosome NCBI id location
grasscarp (Ctenopharyngodon idella) G83707 NA non-coding CI01000013 null 8687827 ~ 8688071 (-)
striped catfish (Pangasianodon hypophthalmus) G80236 pou2f1b,LOC107695465,LOC108426038,LOC107595807 non-coding NC_047599.1 CM018545.1 10525969 ~ 10526615 (+)
tiger barb (Puntius tetrazona) G70837 pou2f1,LOC108266565 non-coding NC_056707.1 CM032076.1 16814830 ~ 16815402 (+)