G61218


Basic Information

Item Value
gene id G61218
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000010
NCBI id null
chromosome length 12265998
location 1250245 ~ 1250446 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU69733
AGAATTCATAAAAGTTGAACAAAACCTGTAAAAATCAAAATTTTTTGGTCGCAGAGCGTATTCTGTGAAAAATCCTATTGGGTTTTTGTCAAGGGAACCAAGGTGATGCTAACTTTTGGGTTGGCTTTCCAAAATCATCACTACAGCACTATTGTGATGTACATCTGACTGAAACAGATTATTGAAAAAGGAAAAAACGTAG

Function

NR:

description
membrane-associated guanylate kinase, WW and PDZ domain-containing protein 2-like

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU69733 True 202 lncRNA 0.35 1 1250245 1250446

Neighbor

gene id symbol gene type direction distance location
CI01000010_01239096_01245966 RL10A, RPL10A coding upstream 4254 1239029 ~ 1245991 (+)
CI01000010_01235831_01238043 NA coding upstream 11597 1235373 ~ 1238648 (+)
CI01000010_01227374_01232982 PPARDB, PPARD, PPARB2A coding upstream 16380 1225615 ~ 1233865 (+)
CI01000010_01202099_01209001 TBC1D25 coding upstream 40072 1202099 ~ 1210173 (+)
CI01000010_01189138_01199101 NT5DC2-B, NT5DC2 coding upstream 50224 1189138 ~ 1200021 (+)
CI01000010_01274112_01288620 NA coding downstream 23666 1274112 ~ 1288780 (+)
CI01000010_01299770_01313065 NA coding downstream 48580 1299026 ~ 1313116 (+)
CI01000010_01335600_01340362 NA coding downstream 85154 1335600 ~ 1340743 (+)
CI01000010_01353784_01361926 NA coding downstream 103338 1353784 ~ 1361998 (+)
CI01000010_01382147_01388079 NA coding downstream 131701 1382147 ~ 1388431 (+)
G60915 NA non-coding upstream 230760 1019017 ~ 1019485 (+)
G60852 NA non-coding upstream 291198 948857 ~ 959047 (+)
G60817 NA non-coding upstream 460819 788888 ~ 789426 (+)
G60801 NA non-coding upstream 514236 727837 ~ 736009 (+)
G60780 NA non-coding upstream 572138 673066 ~ 678107 (+)
G61220 NA non-coding downstream 1890 1252336 ~ 1252899 (+)
G61219 NA non-coding downstream 2622 1253068 ~ 1253739 (+)
G61221 NA non-coding downstream 3530 1253976 ~ 1255045 (+)
G61222 NA non-coding downstream 4892 1255338 ~ 1255572 (+)
G61223 NA non-coding downstream 10146 1260592 ~ 1260909 (+)
CI01000010_00946586_00947327 NA other upstream 302701 945182 ~ 947577 (+)
CI01000010_00881905_00883563 NA other upstream 366731 881195 ~ 883684 (+)
CI01000010_00826648_00831638 NA other upstream 411813 826648 ~ 832705 (+)
CI01000010_03197380_03199958 NA other downstream 1943709 3197380 ~ 3200044 (+)
CI01000010_03320340_03346243 NA other downstream 2063249 3313695 ~ 3347796 (+)
G62838 NA other downstream 2639649 3890095 ~ 3893793 (+)
G62856 NA other downstream 2687311 3937757 ~ 3939945 (+)
G62983 NA other downstream 3197726 4448172 ~ 4449327 (+)

Expression


Co-expression Network