G74477


Basic Information

Item Value
gene id G74477
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000012
NCBI id null
chromosome length 13770000
location 7833362 ~ 7836466 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU84945
ACTGCATTCAACCATTTCTGTCTGTCTGCAAAGTAGTCTCCAATGGCATTGTAGGCCTGCTCCAGAAGAGAATCATCAGAGTCACCTGATCCTGTCTTCAGCAACTGCAGAACCCTGAACCAATCACCGAGCTTTATACGCAAACTGATCGCCAAATCCCTGCGGTCCATGTCCAGGTACATCCTCTCTGCCTCCTCGAACCTGCTGAAGTAAGCAGCTACCTCGGCCTGTTTCATGGCTTCACTCTGCAGGTTGCTCAGTCTCTTCACAAATTCAATGCCCTGGTAGTCCCTACAGCGCACAAACGCCTGTTCAGCCATCTTCAAATCCAGCTTCTGCAGTGCCGCTTCTGCCAACAGACGCC

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU84945 True 364 lncRNA 0.51 3 7833362 7836466

Neighbor

gene id symbol gene type direction distance location
CI01000012_07813654_07814853 NA coding downstream 18509 7812900 ~ 7814853 (-)
CI01000012_07761466_07761786 NA coding downstream 71231 7761432 ~ 7762131 (-)
CI01000012_07716912_07750520 SOBPA coding downstream 82842 7716655 ~ 7750520 (-)
CI01000012_07705100_07707005 NA coding downstream 126135 7703949 ~ 7707227 (-)
CI01000012_07556881_07563284 ARG2 coding downstream 269969 7556106 ~ 7563393 (-)
CI01000012_07925520_07928491 RDH14, RDH14A coding upstream 88990 7925456 ~ 7928491 (-)
CI01000012_07930029_07934648 5NT1A, NT5C1BA coding upstream 92826 7929292 ~ 7934881 (-)
CI01000012_07938822_07940632 NA coding upstream 102348 7938814 ~ 7941045 (-)
CI01000012_07956050_07959414 NA coding upstream 119521 7955987 ~ 7959414 (-)
CI01000012_08156754_08159438 OSR1 coding upstream 319603 8156069 ~ 8159438 (-)
G74381 NA non-coding downstream 138665 7693376 ~ 7694697 (-)
G74378 NA non-coding downstream 231980 7601141 ~ 7601382 (-)
G74376 NA non-coding downstream 235243 7597913 ~ 7598119 (-)
G74363 NA non-coding downstream 269363 7563722 ~ 7563999 (-)
G74113 NA non-coding downstream 487578 7345481 ~ 7345784 (-)
G74490 NA non-coding upstream 18833 7855299 ~ 7855653 (-)
G74492 NA non-coding upstream 32918 7869384 ~ 7869615 (-)
G74498 NA non-coding upstream 62151 7898617 ~ 7898858 (-)
G74500 NA non-coding upstream 66514 7902980 ~ 7903181 (-)
G74501 NA non-coding upstream 66830 7903296 ~ 7903629 (-)
CI01000012_07356934_07358497 NA other downstream 474817 7356863 ~ 7358612 (-)
G72629 NA other downstream 1685868 6147011 ~ 6147494 (-)
G72294 NA other downstream 2367505 5462840 ~ 5465857 (-)
CI01000012_05414096_05416676 TTC9 other downstream 2416582 5413369 ~ 5416780 (-)
G72204 NA other downstream 2531156 5293773 ~ 5302206 (-)
G74648 NA other upstream 427863 8264329 ~ 8265654 (-)
G74701 NA other upstream 530553 8367019 ~ 8367643 (-)
CI01000012_09068458_09070536 NA other upstream 1231440 9067906 ~ 9070765 (-)
CI01000012_09071892_09073410 NA other upstream 1234905 9071371 ~ 9073457 (-)
CI01000012_09082056_09083285 NA other upstream 1246270 9081877 ~ 9083489 (-)

Expression


Co-expression Network