G78997



Basic Information


Item Value
gene id G78997
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information


Item Value
chromosome id CI01000013
NCBI id null
chromosome length 12551977
location 1955434 ~ 1955667 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence


>TU89999
GATTGGCTGCAATGATCAACGCACAGGAGTGTTTGAATATGAAAGCGGGAGCGTGTCAAAGCAGGCGTCTATCAGTGGACCGGTCCGTTGATAGACGCCTGCTTTCAAACTCTCCAGTGTGTATCTGTGTAAGCACTCGGTGAAGAGCGTCATTGATGTTTATTTACAACATGTTTTTGAAACGTTGATCACTGTAGCCAATCACAGACATATCTGTTGAGCGCGTGAACACAA

Function


GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA


RNA id representative length rna type GC content exon number start site end site
TU89999 True 234 lncRNA 0.46 1 1955434 1955667

Neighbor


gene id symbol gene type direction distance location
CI01000013_01789191_01802356 NA coding downstream 152676 1789173 ~ 1802758 (-)
CI01000013_01685711_01689064 NA coding downstream 266040 1685643 ~ 1689394 (-)
CI01000013_01639151_01640992 LYSMD4 coding downstream 314442 1638986 ~ 1640992 (-)
CI01000013_01628415_01628978 NA coding downstream 326407 1628016 ~ 1629027 (-)
CI01000013_01542316_01542809 NA coding downstream 412523 1542125 ~ 1542911 (-)
CI01000013_02009256_02029638 NA coding upstream 53584 2009251 ~ 2029797 (-)
CI01000013_02144531_02157776 NA coding upstream 188317 2143984 ~ 2158007 (-)
CI01000013_02295361_02314298 MCTP2A coding upstream 339121 2294788 ~ 2314812 (-)
CI01000013_02321895_02371964 MEF2A, MEF2AA coding upstream 366228 2321895 ~ 2371964 (-)
CI01000013_02483356_02484395 NA coding upstream 527103 2482770 ~ 2484395 (-)
G78891 NA non-coding downstream 176348 1778721 ~ 1779086 (-)
G78886 NA non-coding downstream 182980 1772252 ~ 1772454 (-)
G78851 NA non-coding downstream 263147 1692078 ~ 1692287 (-)
G78841 NA non-coding downstream 305049 1650097 ~ 1650385 (-)
G78840 NA non-coding downstream 311342 1643831 ~ 1644092 (-)
G78974 NA non-coding upstream 24885 1980552 ~ 1986923 (-)
G78978 NA non-coding upstream 45863 2001530 ~ 2002778 (-)
G78999 NA non-coding upstream 47651 2003318 ~ 2003606 (-)
G79001 NA non-coding upstream 50727 2006394 ~ 2006716 (-)
G79002 NA non-coding upstream 51232 2006899 ~ 2007142 (-)
G78296 NA other downstream 1928537 26528 ~ 26897 (-)
G79690 NA other upstream 857580 2813247 ~ 2815392 (-)
G80262 NA other upstream 1609504 3565171 ~ 3567537 (-)
G80271 NA other upstream 1763766 3719433 ~ 3723607 (-)
G80399 NA other upstream 1948400 3904067 ~ 3906240 (-)
G80443 NA other upstream 2109275 4064942 ~ 4066017 (-)

Expression



Co-expression Network