G308506 (abcc5,LOC106580650,LOC107670605,LOC107671530,LOC107672635)


Basic Information

Item Value
gene id G308506
gene name abcc5,LOC106580650,LOC107670605,LOC107671530,LOC107672635
gene type unknown
species mexican tetra (Astyanax mexicanus)
category of species ornamental fish

Chromosome Information

Item Value
chromosome id NW_019172850.1
NCBI id APWO02000117.1
chromosome length 3115925
location 2017464 ~ 2020131 (+)
genome version Astyanax_mexicanus-2.0_2017_mexican_tetra_Genome

Sequence

>TU424711
GTTCCTCTGAATACTGGTTAAATGGATCAAGATTAGACCTCACAGTGCCACTGAAGAGCACAGGCTCCTGTGGGATGATGGAGAGCTTGCTGCGTAGATCAGCAAGTCCGATGTCACAGATGTTGATGCCGTCTATGTTAATGGTGCCACCGCACGGCTCCACCAGCCGGAACAGAACTACGCCCAGTGAGGACTTCCCTGAACCTGTTCGACCCACGATCCCAACCTTCTCCTTGGGCCGGATGGTGCAGGACAGTTTCTTCAATACCAGTGGGAGGTTCTCTCTGTACCTCATCTCTACCCCATCAAACACCACCTCACCCT

Function

symbol description
abcc5 Predicted to enable ATPase-coupled transmembrane transporter activity. Acts upstream of or within erythrocyte differentiation and heme transmembrane transport. Predicted to be integral component of membrane. Predicted to be active in membrane. Is expressed in several structures, including heart; liver; nervous system; pleuroperitoneal region; and solid lens vesicle. Orthologous to human ABCC5 (ATP binding cassette subfamily C member 5).

NR:

description
PREDICTED: multidrug resistance-associated protein 5

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU424711 True 324 TUCP 0.53 3 2017464 2020131

Neighbor

gene id symbol gene type direction distance location
LOC103031553 pcyt1a,LOC108440592,LOC108264716,LOC107091881 coding upstream 169880 1834677 ~ 1847584 (+)
LOC103029868 NA coding upstream 226588 1787316 ~ 1790876 (+)
omp omp,ompa,LOC107660685,LOC107735103 coding upstream 267221 1745320 ~ 1750243 (+)
LOC103038299 gdpd4a,LOC108431176,LOC108264809,LOC107735911,LOC107660699 coding upstream 383255 1585462 ~ 1634209 (+)
pak1 pak1 coding upstream 453000 1461963 ~ 1564464 (+)
cstf3 cstf3,LOC107671440 coding downstream 56470 2076601 ~ 2112984 (+)
eif3m eif3m,LOC107602127,LOC107671036 coding downstream 201838 2221969 ~ 2236883 (+)
pex16 pex16,LOC107753012,LOC107669959,LOC106593118 coding downstream 973937 2994068 ~ 3009972 (+)
LOC103038331 LOC108433450 coding downstream 999028 3019159 ~ 3035820 (+)
cep126 NA coding downstream 1050105 3070236 ~ 3107407 (+)
G308501 rnpepl1 non-coding upstream 18717 1997233 ~ 1998747 (+)
G308474 NA non-coding upstream 83346 1862898 ~ 1934118 (+)
G308470 NA non-coding upstream 106819 1854641 ~ 1910645 (+)
G308457 NA non-coding upstream 193869 1789538 ~ 1823595 (+)
G308465 NA non-coding upstream 198363 1817060 ~ 1819101 (+)
G308521 NA non-coding downstream 66977 2087108 ~ 2088169 (+)
G308552 NA non-coding downstream 174860 2194991 ~ 2195304 (+)
G308549 NA non-coding downstream 178709 2198840 ~ 2207792 (+)
G308640 NA non-coding downstream 226180 2246311 ~ 2265533 (+)
G308645 NA non-coding downstream 280811 2300942 ~ 2301238 (+)
serp1 NA other upstream 184790 1827904 ~ 1832674 (+)
G308090 NA other upstream 1831389 185337 ~ 186075 (+)
G308535 depdc7,LOC107758055,LOC107576633 other downstream 110948 2131079 ~ 2143963 (+)
G308643 kifc3 other downstream 299760 2319891 ~ 2338166 (+)
G308680 NA other downstream 536196 2556327 ~ 2556569 (+)

Expression


Co-expression Network