G84541



Basic Information


Item Value
gene id G84541
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information


Item Value
chromosome id CI01000013
NCBI id null
chromosome length 12551977
location 11380671 ~ 11380906 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence


>TU96198
CTCTGAGACAGAAAGAGAAAGAAAATGGAGAATTCAAAACAACCCAATATGGTTCTCCTGGGGTGTGCATGCATTCCTCTTACCGTTGCTGGAGATGCAGGCAGACAGTGTTTTAGTGATTACCGTAGCCATCTTACAAGCAGCAGCACTGTGTGCCGACTGAGACAAAACTCTGGTAAGAGTGTCTGAGAGTGAATTAAGGCCTCCCACTGACACAAAATACTCCTGAGCACAAG

Function


GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA


RNA id representative length rna type GC content exon number start site end site
TU96198 True 236 lncRNA 0.46 1 11380671 11380906

Neighbor


gene id symbol gene type direction distance location
CI01000013_11365641_11366348 NA coding upstream 13963 11365185 ~ 11366708 (+)
CI01000013_11326503_11335221 NA coding upstream 45157 11326503 ~ 11335514 (+)
CI01000013_11287928_11292308 NA coding upstream 88264 11287928 ~ 11293107 (+)
CI01000013_11271292_11274155 NA coding upstream 105917 11270606 ~ 11274754 (+)
CI01000013_11224779_11252341 SHANK3A, SHANK3 coding upstream 127667 11224698 ~ 11253004 (+)
CI01000013_11384868_11387085 PDP2 coding downstream 3962 11384868 ~ 11387402 (+)
CI01000013_11389357_11391382 NA coding downstream 8451 11389357 ~ 11391382 (+)
CI01000013_11392513_11399953 NA coding downstream 11607 11392513 ~ 11400050 (+)
CI01000013_11402841_11414169 NA coding downstream 21935 11402841 ~ 11415293 (+)
CI01000013_11417261_11421230 NA coding downstream 36355 11417261 ~ 11421248 (+)
G84510 NA non-coding upstream 18847 11361608 ~ 11361824 (+)
G84500 NA non-coding upstream 43117 11337345 ~ 11337554 (+)
G84421 NA non-coding upstream 58588 11320829 ~ 11322083 (+)
G84494 NA non-coding upstream 68009 11312369 ~ 11312662 (+)
G84544 NA non-coding downstream 2159 11383065 ~ 11383274 (+)
G84550 NA non-coding downstream 24690 11405596 ~ 11405888 (+)
G84568 NA non-coding downstream 72204 11453110 ~ 11514034 (+)
G84573 NA non-coding downstream 96898 11477804 ~ 11480707 (+)
G84584 NA non-coding downstream 123837 11504743 ~ 11510673 (+)
CI01000013_10756927_10790192 FRMD4A other upstream 595914 10756927 ~ 10792761 (+)
G84250 NA other upstream 1164709 10215127 ~ 10215962 (+)
G84215 NA other upstream 1301335 10076454 ~ 10079336 (+)
G84194 NA other upstream 1343878 10030608 ~ 10036953 (+)
G84005 NA other upstream 1778436 9601611 ~ 9602235 (+)
G84768 NA other downstream 789083 12169989 ~ 12170818 (+)
G84790 NA other downstream 804036 12184942 ~ 12201975 (+)
G84864 NA other downstream 984143 12365049 ~ 12375905 (+)

Expression



Co-expression Network