G86186


Basic Information

Item Value
gene id G86186
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000014
NCBI id null
chromosome length 1317303
location 1068620 ~ 1068838 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU98159
TAAATGTAGAAGAGAGAATAATCAATGATGAACACAGCTGAGGCTGATCACAGCTGATCTAAACCTTGTGTTACATTTATTACCATTAATATTTCTACAACAGTGTGTCTTGTACTACATGTATAAATGTAATCATTTAAATGGATTACCGTGATATTTATACCTTTTTCTCACTGAAACCCTCAAATTGTTAGTGCTTAAATTTAGTTGCATTCAAAC

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU98159 True 219 lncRNA 0.31 1 1068620 1068838

Neighbor

gene id symbol gene type direction distance location
CI01000014_01038876_01053268 H2AFY coding upstream 14587 1037623 ~ 1054033 (+)
CI01000014_01032668_01033192 NA coding upstream 35428 1032010 ~ 1033192 (+)
CI01000014_00989016_01007020 NA coding upstream 61544 988526 ~ 1007076 (+)
CI01000014_00974308_00976120 NA coding upstream 92385 974308 ~ 976235 (+)
CI01000014_00939523_00954114 LARP1 coding upstream 114310 939523 ~ 954310 (+)
CI01000014_01112526_01115371 PITX1 coding downstream 43688 1112526 ~ 1115375 (+)
CI01000014_01197756_01204104 SAR1A, SAR1B coding downstream 128711 1197549 ~ 1204647 (+)
CI01000014_01276527_01296594 ACSL6 coding downstream 207689 1276527 ~ 1296941 (+)
CI01000014_01300085_01300410 NA coding downstream 231247 1300085 ~ 1300513 (+)
G86177 NA non-coding upstream 38795 1029570 ~ 1029825 (+)
G86153 NA non-coding upstream 44999 1022948 ~ 1023621 (+)
G86176 NA non-coding upstream 46475 1021931 ~ 1022145 (+)
G86172 NA non-coding upstream 48795 1019450 ~ 1019825 (+)
G86170 NA non-coding upstream 52004 1016348 ~ 1016616 (+)
G86215 NA non-coding downstream 12286 1081124 ~ 1081339 (+)
G86210 NA non-coding downstream 75090 1143928 ~ 1144467 (+)
G86230 NA non-coding downstream 103843 1172681 ~ 1172913 (+)
G86195 NA non-coding downstream 154640 1223478 ~ 1257099 (+)
G86209 NA non-coding downstream 158579 1227417 ~ 1238530 (+)
G86111 NA other upstream 297637 770224 ~ 770983 (+)

Expression


Co-expression Network