CI01000016_09364728_09366356 (VAMP1)


Basic Information

Item Value
gene id CI01000016_09364728_09366356
gene name VAMP1
gene type coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000016
NCBI id null
chromosome length 12175457
location 9364649 ~ 9366356 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>CI01000016_09364728_09366356.mRNA
GCATATATGCGTCAGAATATTGGCCTAATGTTTGATAGGCTATGAGAGACATACTTGCTTATATGCAGGACTTGAGAGCATGTGTAGTGTGGGGTATATGGAGAAACCAGTTATCAGAGAGAAGAAAAGTCCCTTCAGAAAGAACAAGCCGACTCAGCACTCTGAACTGACTGATGTACCGCAGTCTGCTGCAGATGATGCTAACCCAGCGGGTGCTCCTGGAGCCCCAGGTGGCCCTGGAGGAGCCGGTCCTCCTGCTCCCCCTCCAAACACCACCAGCAACCGCAGACTACAGCAGACACAAGCACAAGTGGAGGAGGTGGTGGATATCATGCGTGTGAATGTAGATAAGGTTCTGGAGAGAGACCAGAAGCTGTCTGAGCTAGACGACAGGGCAGATGCTCTGCAGGCCGGGGCTTCACAGTTCGAAAGCTGTGCTGCCAAACTGAAGAACAAATACTGGTGGAAGAATTGCAAG

Function

symbol description
vamp1 Predicted to enable SNAP receptor activity and syntaxin-1 binding activity. Predicted to be involved in SNARE complex assembly. Predicted to act upstream of or within vesicle-mediated transport. Predicted to be located in membrane. Predicted to be integral component of membrane. Predicted to be part of SNARE complex. Predicted to be active in plasma membrane. Is expressed in nervous system and neural tube. Human ortholog(s) of this gene implicated in congenital myasthenic syndrome and spastic ataxia 1. Orthologous to human VAMP1 (vesicle associated membrane protein 1).

GO: NA

KEGG:

id description
K08510 VAMP1; vesicle-associated membrane protein 1

RNA

RNA id representative length rna type GC content exon number start site end site
CI01000016_09364728_09366356.mRNA True 478 mRNA 0.51 3 9364649 9366356

Neighbor

gene id symbol gene type direction distance location
CI01000016_09363759_09363932 NA coding upstream 276 9363759 ~ 9364373 (+)
CI01000016_09357617_09361063 PSMD4B, PSMD4, PSMD4A coding upstream 3586 9357617 ~ 9361063 (+)
CI01000016_09340494_09349036 PIP5K1A, PIP5K1AB coding upstream 15613 9340494 ~ 9349036 (+)
CI01000016_09317824_09332379 NA coding upstream 31935 9317722 ~ 9332714 (+)
CI01000016_09299769_09306497 RORC coding upstream 57264 9299769 ~ 9307385 (+)
CI01000016_09524279_09527107 NA coding downstream 157261 9523617 ~ 9527207 (+)
CI01000016_09615039_09616082 NA coding downstream 246435 9612791 ~ 9617419 (+)
CI01000016_09663511_09664293 NA coding downstream 297155 9663511 ~ 9664495 (+)
CI01000016_09664848_09674309 CEP192, SEH1L coding downstream 298492 9664848 ~ 9674728 (+)
CI01000016_09686132_09706397 CEP192 coding downstream 319776 9686132 ~ 9706453 (+)
G98280 NA non-coding upstream 137741 9224449 ~ 9226908 (+)
G98392 NA non-coding upstream 152883 9211350 ~ 9211766 (+)
G98391 NA non-coding upstream 188689 9175199 ~ 9175960 (+)
G98385 NA non-coding upstream 238718 9125719 ~ 9125931 (+)
G98375 NA non-coding upstream 266546 9085228 ~ 9098103 (+)
G98271 NA non-coding downstream 9861 9376217 ~ 9378050 (+)
G98409 NA non-coding downstream 33599 9399955 ~ 9402046 (+)
G98414 NA non-coding downstream 37511 9403867 ~ 9404218 (+)
G98415 NA non-coding downstream 38011 9404367 ~ 9404679 (+)
G98416 NA non-coding downstream 38662 9405018 ~ 9405471 (+)
G98288 NA other upstream 361932 8996098 ~ 9002717 (+)
G97824 NA other upstream 1348874 8014363 ~ 8015775 (+)
CI01000016_07784248_07784757 TWIST1, TWIST1.L, TWIST1A, TWIST1B, TWST2, TWIST1.S other upstream 1578926 7783987 ~ 7784996 (+)
G96389 NA other upstream 2203359 7160641 ~ 7161290 (+)
CI01000016_05405791_05407797 AICDA other upstream 3956786 5405791 ~ 5407963 (+)
CI01000016_09796196_09842235 NA other downstream 429275 9795950 ~ 9842576 (+)
G99041 NA other downstream 558062 9924418 ~ 9925654 (+)
G99410 NA other downstream 868044 10234400 ~ 10236851 (+)
G99456 NA other downstream 928035 10294391 ~ 10298904 (+)
G99940 NA other downstream 2305289 11671645 ~ 11672873 (+)

Expression


Co-expression Network

Homologous

species gene id symbol gene type chromosome NCBI id location
zebrafish (Danio rerio) XLOC_009711 zgc:92912 coding NC_007127.7 CM002900.2 9779680 ~ 9786259 (+)