G98530


Basic Information

Item Value
gene id G98530
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000016
NCBI id null
chromosome length 12175457
location 8355495 ~ 8355695 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU112113
CGCCCATGGGCGTGCTGGTCTGAAAACCAGGTGTGTTCAGGCGCATTGTTGGCGTGTTGCTATTTTGAGGCAACTGAAATAGACTGTGCCACTGACCAACTGAAATCTGGTCTAAAGTCAATGGTGCAATATTTTTTTTATTTAAAGAGCGCGTTAGTGATATGCGCCTATAGGCAGGTGCACAACACGGGTACACTCTGC

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU112113 True 201 lncRNA 0.47 1 8355495 8355695

Neighbor

gene id symbol gene type direction distance location
CI01000016_08232249_08261533 TAX1BP1, TAX1BP1B coding downstream 93962 8231563 ~ 8261533 (-)
CI01000016_08229709_08230108 NA coding downstream 125387 8229460 ~ 8230108 (-)
CI01000016_08111153_08185623 CREB5 coding downstream 169872 8111153 ~ 8185623 (-)
CI01000016_08042288_08066945 CHN2 coding downstream 288290 8040556 ~ 8067205 (-)
CI01000016_08039526_08039834 NA coding downstream 315661 8039484 ~ 8039834 (-)
CI01000016_08374296_08376159 SNX10B coding upstream 18555 8374250 ~ 8376159 (-)
CI01000016_08379971_08382899 CBX3B coding upstream 23588 8379283 ~ 8384036 (-)
CI01000016_08385655_08387187 NA coding upstream 29881 8385576 ~ 8387661 (-)
CI01000016_08421119_08444481 PDE11AL coding upstream 65402 8421097 ~ 8445102 (-)
CI01000016_08570850_08582638 MPP6, MPP6A coding upstream 214598 8570293 ~ 8582907 (-)
G98529 NA non-coding downstream 2915 8352320 ~ 8352580 (-)
G98512 NA non-coding downstream 33119 8322155 ~ 8322376 (-)
G98511 NA non-coding downstream 48913 8304554 ~ 8306582 (-)
G98501 NA non-coding downstream 60074 8293117 ~ 8295421 (-)
G98506 NA non-coding downstream 75100 8280134 ~ 8280395 (-)
G98541 NA non-coding upstream 36393 8392088 ~ 8403030 (-)
G98545 NA non-coding upstream 50302 8405997 ~ 8406296 (-)
G98521 NA non-coding upstream 63649 8419344 ~ 8420716 (-)
G98558 NA non-coding upstream 103380 8459075 ~ 8459357 (-)
G98559 NA non-coding upstream 104661 8460356 ~ 8460567 (-)
G97341 NA other downstream 2195774 6158986 ~ 6159721 (-)
CI01000016_05412782_05415867 NA other downstream 2937278 5412248 ~ 5415906 (-)
CI01000016_05325805_05330265 COX6B2 other downstream 3024649 5325519 ~ 5332874 (-)
CI01000016_04921091_04922518 NA other downstream 3432091 4918975 ~ 4922518 (-)
CI01000016_03921124_03930996 NA other downstream 4424444 3920055 ~ 3931162 (-)
CI01000016_08893013_08893496 NPPCL, ANFC1 other upstream 533138 8888833 ~ 8894737 (-)
CI01000016_08926089_08945071 NA other upstream 581094 8925960 ~ 8945229 (-)
G98679 NA other upstream 879301 9234996 ~ 9239929 (-)
G98691 NA other upstream 900407 9256102 ~ 9257611 (-)
CI01000016_09510177_09512196 ID4 other upstream 1153927 9509622 ~ 9512428 (-)

Expression


Co-expression Network