G123583


Basic Information

Item Value
gene id G123583
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000024
NCBI id null
chromosome length 8644187
location 3406066 ~ 3407292 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU140328
AGCTCTATAAAATACAAGCAACTGATGAAATGTTTTTCCATGATTGTAGGTGGTTAGTACACAAACACAGATTTATTTACAGATCTAGCCTGTTTCTCTTTATCTGTTTAGGACTCATATGTCATACTCCACTTCATCCAGTAATTGGCTTTTCAATTTATTTAATGCAACTCAAATTCCCACATGGGATCAATAAAGTGTAAATCGATTTAATGTTTATTTTATGCATCCATTATGTATTACACAGCCATTAACGACGACACACTGATGTCCTAAGACACTGCCTTGCGCACTGCATCTGGTGCGTGAGGTGTTTGGACATAGTGGTGTATTAGAGGTAAAAAAT

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU140328 True 346 lncRNA 0.36 3 3406066 3407292

Neighbor

gene id symbol gene type direction distance location
CI01000024_03311028_03319956 NA coding downstream 86110 3310997 ~ 3319956 (-)
CI01000024_03284853_03286057 NA coding downstream 120009 3284210 ~ 3286057 (-)
CI01000024_03208565_03262749 KCNH7 coding downstream 143317 3208565 ~ 3262749 (-)
CI01000024_03060967_03068650 MTX2 coding downstream 336360 3060812 ~ 3069706 (-)
CI01000024_03048421_03049271 NA coding downstream 356537 3048164 ~ 3049529 (-)
CI01000024_03449111_03472001 ATP7B coding upstream 41513 3448805 ~ 3472001 (-)
CI01000024_03473803_03480757 HTR2AB coding upstream 66298 3473590 ~ 3480757 (-)
CI01000024_03499415_03506746 SUCLA2, SUCLA2.S coding upstream 91215 3498507 ~ 3506746 (-)
CI01000024_03526772_03550303 ABI2, ABI2B coding upstream 117912 3525204 ~ 3550303 (-)
CI01000024_03550821_03556930 CYP20A1 coding upstream 143268 3550560 ~ 3556930 (-)
G123557 NA non-coding downstream 27762 3378011 ~ 3378304 (-)
G123555 NA non-coding downstream 29994 3375865 ~ 3376072 (-)
G123377 NA non-coding downstream 58785 3325594 ~ 3347281 (-)
G123403 NA non-coding downstream 67295 3336576 ~ 3338771 (-)
G123369 NA non-coding downstream 251428 3150558 ~ 3154638 (-)
G123584 NA non-coding upstream 15394 3422686 ~ 3423015 (-)
G123593 NA non-coding upstream 28759 3436051 ~ 3436799 (-)
G123560 NA non-coding upstream 31675 3438967 ~ 3522577 (-)
G123639 NA non-coding upstream 265847 3673139 ~ 3673343 (-)
G123641 NA non-coding upstream 273403 3680695 ~ 3680962 (-)
G123233 NA other downstream 851030 2547460 ~ 2555036 (-)
CI01000024_00825386_00837898 NA other downstream 2579215 824968 ~ 838550 (-)
CI01000024_03938368_03941795 NA other upstream 528750 3938315 ~ 3941924 (-)
G125457 NA other upstream 3949945 7357237 ~ 7358104 (-)
G125798 NA other upstream 4568375 7975667 ~ 7976047 (-)

Expression


Co-expression Network