G133112


Basic Information

Item Value
gene id G133112
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000026
NCBI id null
chromosome length 17172400
location 9912402 ~ 9912682 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU151354
CCGAGCAGAAGACAGAGCCCTGATTCAGGATTTAGCGAGAGACTGAGAAAGATAGAGACAGACATGGCCTAGAGAGAGAGAAAGAGAGAGAGAATGAGACGGAAAGAGTAAGGAGAAAGAGGGAGAAACAGAAAGATTGAGAAAGTTTTGCTTTTTACTAAACTGTTTCAAATAGGTGACTTCGCACCTGCTTCAAATTCTGATTTAAAATGCAATACTGCGTAAAGGCGCACTAAAATCAGGGTTGTGCAAAATTGAAAGAGTTCAGAGTTCAATGTCAA

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU151354 True 281 lncRNA 0.41 1 9912402 9912682

Neighbor

gene id symbol gene type direction distance location
CI01000026_09470361_09503958 NA coding downstream 408017 9470297 ~ 9504385 (-)
CI01000026_09233035_09245301 FTO coding downstream 666841 9232857 ~ 9245561 (-)
CI01000026_09203430_09218432 FTO coding downstream 693970 9203430 ~ 9218432 (-)
CI01000026_09147356_09156946 NA coding downstream 753876 9147328 ~ 9158526 (-)
CI01000026_08861639_08866198 IRX5A, IRX5 coding downstream 1044253 8861639 ~ 8868149 (-)
CI01000026_09946977_09948009 NA coding upstream 34248 9946930 ~ 9948167 (-)
CI01000026_09991433_10006016 CYLDA, CYLD coding upstream 78633 9991315 ~ 10006016 (-)
CI01000026_10014914_10019772 NOD2 coding upstream 100893 10013575 ~ 10020199 (-)
CI01000026_10035392_10061141 NKD1 coding upstream 122387 10035069 ~ 10062470 (-)
CI01000026_10133129_10135047 NA coding upstream 220233 10132915 ~ 10135645 (-)
CI01000026_09911514_09913512 NA non-coding downstream 567 9910881 ~ 9913651 (-)
G133104 NA non-coding downstream 34854 9877312 ~ 9877548 (-)
G133096 NA non-coding downstream 58824 9853346 ~ 9853578 (-)
G133095 NA non-coding downstream 59289 9852927 ~ 9853113 (-)
G133045 NA non-coding downstream 108807 9802970 ~ 9803595 (-)
G133121 NA non-coding upstream 16497 9929179 ~ 9929403 (-)
G133123 NA non-coding upstream 17802 9930484 ~ 9930734 (-)
G133128 NA non-coding upstream 32325 9945007 ~ 9945352 (-)
G133070 NA non-coding upstream 61002 9973684 ~ 9974440 (-)
G133143 NA non-coding upstream 115870 10028552 ~ 10028760 (-)
G132721 NA other downstream 361758 9550030 ~ 9550644 (-)
G132575 NA other downstream 524686 9387151 ~ 9387716 (-)
G131742 NA other downstream 1604695 8306776 ~ 8307707 (-)
G130256 NA other downstream 3595248 6275511 ~ 6317154 (-)
G129750 NA other downstream 5093120 4785885 ~ 4820249 (-)
CI01000026_10347872_10351783 CEBPA other upstream 435511 10347746 ~ 10351783 (-)
CI01000026_10788054_10788652 CD59 other upstream 874657 10787339 ~ 10789709 (-)
G133790 NA other upstream 921333 10834015 ~ 10859589 (-)
G133802 NA other upstream 1389233 11301915 ~ 11307181 (-)
G136110 NA other upstream 4642235 14554917 ~ 14555436 (-)

Expression


Co-expression Network