G134589


Basic Information

Item Value
gene id G134589
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000026
NCBI id null
chromosome length 17172400
location 12359897 ~ 12360270 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU153047
GTAGACCCCCTATAGTGTGCGGTGGGTTTTGTGGGGGGTAATAGAGAATGAATGGGGGAAAGTCACGTGAGAGGAGGCAGTGCCTCCATCGCGCTATGATTGGATATGATCGGTTATGATTGGTTTGTGCGATAAATCCCGCCTCTTGTTTACATGCGCATTCCGCGTGTCAGTCTGAATGAACAAAATGATGGCGTCAATGGGAAGACTAATTAAAAAGTAAACGGCTCACCCACTAAGATATCACCGCTTTGTCACGTCAAATTCAAATGTCAAAAGACCTGAAAACACGATGACTGCGGGGGTTTTAGTGAGCAATCAGCTTGGTGAAATTAAAGATACATCTTCGTGTCTGTGACCGAGTGTTTACCGAG

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU153047 True 374 lncRNA 0.46 1 12359897 12360270

Neighbor

gene id symbol gene type direction distance location
CI01000026_12309243_12313256 INSIG1 coding downstream 46472 12309197 ~ 12313425 (-)
CI01000026_12289057_12291515 EN2, ENG2A coding downstream 66479 12288936 ~ 12293418 (-)
CI01000026_12220025_12255410 RBM33 coding downstream 104487 12220025 ~ 12255410 (-)
CI01000026_12132260_12141706 RNF32 coding downstream 218191 12131941 ~ 12141706 (-)
CI01000026_12079761_12087407 NOM1 coding downstream 271473 12079407 ~ 12088424 (-)
CI01000026_12444311_12444646 NA coding upstream 83706 12443976 ~ 12444862 (-)
CI01000026_12445673_12447183 NA coding upstream 85034 12445304 ~ 12448701 (-)
CI01000026_12536781_12546106 KIF9 coding upstream 176511 12536781 ~ 12546529 (-)
CI01000026_12570957_12581387 NA coding upstream 210525 12570795 ~ 12581513 (-)
CI01000026_12591049_12624688 PRKDC coding upstream 230515 12590785 ~ 12626438 (-)
G134588 NA non-coding downstream 2504 12357049 ~ 12357393 (-)
G134580 NA non-coding downstream 7601 12325289 ~ 12352296 (-)
G134579 NA non-coding downstream 37642 12321765 ~ 12322255 (-)
G134578 NA non-coding downstream 38393 12321231 ~ 12321504 (-)
G134577 NA non-coding downstream 41081 12318574 ~ 12318816 (-)
G134635 NA non-coding upstream 35205 12395475 ~ 12395789 (-)
G134593 NA non-coding upstream 190041 12550311 ~ 12557333 (-)
G134619 NA non-coding upstream 227678 12587948 ~ 12590118 (-)
G134673 NA non-coding upstream 269953 12630223 ~ 12632312 (-)
G134674 NA non-coding upstream 273079 12633349 ~ 12634475 (-)
G133802 NA other downstream 1052716 11301915 ~ 11307181 (-)
G133790 NA other downstream 1522292 10834015 ~ 10859589 (-)
CI01000026_10788054_10788652 CD59 other downstream 1569743 10787339 ~ 10789709 (-)
CI01000026_10347872_10351783 CEBPA other downstream 2010940 10347746 ~ 10351783 (-)
G132721 NA other downstream 2809253 9550030 ~ 9550644 (-)
G136110 NA other upstream 2194647 14554917 ~ 14555436 (-)
CI01000026_16756776_16760261 RBPMS2A, RBPMS2B, RBPMS2 other upstream 4396459 16756729 ~ 16761341 (-)
G137667 NA other upstream 4446094 16806364 ~ 16808372 (-)
G137914 NA other upstream 4622981 16983251 ~ 16984352 (-)
G137967 NA other upstream 4708078 17068348 ~ 17069433 (-)

Expression


Co-expression Network